Incidental Mutation 'R2152:Asap2'
ID234420
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms6530401G17Rik, LOC385250, Ddef2
MMRRC Submission 040155-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R2152 (G1)
Quality Score106
Status Not validated
Chromosome12
Chromosomal Location20990459-21270171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21112083 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 14 (T14S)
Ref Sequence ENSEMBL: ENSMUSP00000054631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
Predicted Effect probably damaging
Transcript: ENSMUST00000050990
AA Change: T14S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: T14S

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064595
AA Change: T14S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: T14S

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090834
AA Change: T14S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: T14S

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101562
AA Change: T14S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: T14S

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174530
Meta Mutation Damage Score 0.2341 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,934 D298V probably damaging Het
Ackr3 A T 1: 90,213,843 Y8F probably benign Het
Acy1 T C 9: 106,435,617 E175G probably damaging Het
Add2 T C 6: 86,098,598 L243P probably damaging Het
Adsl A G 15: 80,967,662 D407G probably damaging Het
Afg3l1 T G 8: 123,494,836 I478S probably damaging Het
Arfrp1 T C 2: 181,359,694 T108A probably benign Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bbs12 G T 3: 37,321,160 E586* probably null Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Bid A T 6: 120,900,254 L42Q probably damaging Het
Bpifb9a A G 2: 154,260,135 K51E probably benign Het
Calcr G T 6: 3,687,615 T424K probably benign Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntn3 A G 6: 102,206,537 I719T probably damaging Het
Cyb5r1 T C 1: 134,409,625 I163T possibly damaging Het
Cyp2d26 A T 15: 82,792,706 probably null Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dgcr2 G A 16: 17,891,487 probably null Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dnah3 C T 7: 119,952,013 V3028I probably benign Het
Dnah6 T C 6: 73,049,166 Y3448C probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Doxl2 T A 6: 48,976,539 I466N probably damaging Het
Epb41l1 A G 2: 156,514,128 D528G probably damaging Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fgfr4 A T 13: 55,166,964 Y640F probably damaging Het
Foxo6 T A 4: 120,268,614 D328V probably benign Het
Foxp1 A G 6: 99,016,541 L134P probably damaging Het
Frem2 G A 3: 53,517,029 R2996* probably null Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gcn1l1 T A 5: 115,609,829 I1765N probably benign Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gpc6 G T 14: 116,926,092 A53S probably benign Het
Gtpbp8 A G 16: 44,740,027 probably null Het
H2-Q2 T C 17: 35,345,276 probably null Het
Hapln2 C A 3: 88,023,613 R157L probably benign Het
Hemgn C A 4: 46,396,607 E210* probably null Het
Hpse T A 5: 100,691,403 K360* probably null Het
Iqcj A T 3: 68,055,310 E68V probably damaging Het
Kat2a T C 11: 100,712,346 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Klhl30 C A 1: 91,357,824 A356D probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Micu1 G T 10: 59,863,288 M468I probably benign Het
Mrc1 A G 2: 14,327,864 T1292A probably damaging Het
Myh8 G A 11: 67,294,469 E849K probably damaging Het
Myom3 G T 4: 135,803,233 R1152L probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 noncoding transcript Het
Olfr1339 C T 4: 118,735,249 A240V possibly damaging Het
Olfr1413 T C 1: 92,573,908 S246P probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr33 G T 7: 102,713,581 H277Q probably benign Het
Olfr435 A G 6: 43,202,069 I142V probably benign Het
Olfr592 A T 7: 103,186,640 D13V probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Olfr969 A T 9: 39,795,647 I91F probably benign Het
Otop1 T A 5: 38,302,851 M587K probably damaging Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phc2 A G 4: 128,745,066 *41W probably null Het
Piezo2 A T 18: 63,114,041 M532K probably damaging Het
Pjvk A T 2: 76,658,369 I295F probably benign Het
Popdc2 A G 16: 38,363,120 N155S possibly damaging Het
Ppp4r3a G T 12: 101,042,567 N684K probably damaging Het
Prpf4b T A 13: 34,900,419 M930K probably benign Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Ptprz1 C A 6: 23,030,671 L1010I probably damaging Het
Rabepk A T 2: 34,784,550 D232E possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rb1 T C 14: 73,288,725 T169A probably benign Het
Rcc2 T C 4: 140,717,117 L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Sdk1 A G 5: 141,792,944 N226D probably damaging Het
Selenbp1 G A 3: 94,944,130 R398H probably damaging Het
Selenoo A G 15: 89,099,282 M509V probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc2a5 T G 4: 150,125,638 S27A probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slc5a9 A G 4: 111,893,223 I146T possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Snx29 A G 16: 11,400,843 D181G possibly damaging Het
Spata31d1c G A 13: 65,033,965 probably null Het
Stat5a C A 11: 100,874,090 T213N probably benign Het
Stt3a A T 9: 36,747,996 V349D probably damaging Het
Tcf20 A T 15: 82,855,602 D549E probably damaging Het
Thbs2 T A 17: 14,673,209 D903V probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmc1 A T 19: 20,856,675 N241K probably benign Het
Tmem260 G T 14: 48,477,609 R240L possibly damaging Het
Tnfaip6 A T 2: 52,043,730 E32D probably damaging Het
Trpa1 A T 1: 14,899,401 H381Q probably damaging Het
Tsen2 T C 6: 115,547,975 I45T possibly damaging Het
Ttc6 G A 12: 57,705,552 V1415I probably damaging Het
Ttll7 G T 3: 146,930,189 R426L probably damaging Het
Ttn A C 2: 76,740,138 S26804A probably damaging Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn2r73 A G 7: 85,857,728 V792A probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21239648 missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21206316 missense probably damaging 1.00
IGL01285:Asap2 APN 12 21229263 missense probably damaging 1.00
IGL01318:Asap2 APN 12 21247295 missense probably null 0.00
IGL01355:Asap2 APN 12 21218086 splice site probably benign
IGL01593:Asap2 APN 12 21213202 missense probably null 0.03
IGL01705:Asap2 APN 12 21249368 missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21254306 missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21265910 missense probably damaging 1.00
IGL02876:Asap2 APN 12 21258163 missense probably benign 0.00
IGL02991:Asap2 APN 12 21249293 splice site probably benign
R0157:Asap2 UTSW 12 21206325 missense probably damaging 1.00
R0399:Asap2 UTSW 12 21217997 missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21213185 missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21247319 missense probably damaging 1.00
R0981:Asap2 UTSW 12 21265960 missense probably damaging 0.98
R1141:Asap2 UTSW 12 21185110 missense probably damaging 1.00
R1382:Asap2 UTSW 12 21265954 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239585 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239589 missense probably damaging 1.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1526:Asap2 UTSW 12 21185187 missense probably damaging 1.00
R1542:Asap2 UTSW 12 21265997 missense probably damaging 1.00
R1710:Asap2 UTSW 12 21224392 missense probably damaging 1.00
R1750:Asap2 UTSW 12 21203998 missense probably damaging 1.00
R2151:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2154:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2323:Asap2 UTSW 12 21203968 missense probably damaging 1.00
R2378:Asap2 UTSW 12 21254318 missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21224377 missense probably damaging 1.00
R3757:Asap2 UTSW 12 21267766 missense probably damaging 1.00
R4305:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4307:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4308:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4345:Asap2 UTSW 12 21230831 missense probably damaging 1.00
R4525:Asap2 UTSW 12 21229292 splice site probably null
R4562:Asap2 UTSW 12 21112093 missense probably damaging 1.00
R4999:Asap2 UTSW 12 21252765 missense probably benign 0.19
R5027:Asap2 UTSW 12 21204081 missense probably damaging 1.00
R5221:Asap2 UTSW 12 21213190 missense probably benign 0.14
R5645:Asap2 UTSW 12 21265982 missense probably damaging 0.99
R5799:Asap2 UTSW 12 21168246 missense probably damaging 1.00
R5876:Asap2 UTSW 12 21212809 missense possibly damaging 0.88
R5888:Asap2 UTSW 12 21218190 missense probably damaging 1.00
R5912:Asap2 UTSW 12 21206343 missense probably damaging 1.00
R6576:Asap2 UTSW 12 21244703 missense probably damaging 1.00
R6896:Asap2 UTSW 12 21265525 missense probably damaging 1.00
R6934:Asap2 UTSW 12 21168250 missense probably damaging 1.00
R7134:Asap2 UTSW 12 21265963 nonsense probably null
R7347:Asap2 UTSW 12 21229457 missense probably benign 0.03
R7515:Asap2 UTSW 12 21229239 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCTGGGCTCGCTCGAAGA -3'
(R):5'- CCAGAAACTTTTCCAGGGTGT -3'

Sequencing Primer
(F):5'- TCCAGGAGCACAGCGGG -3'
(R):5'- AGGGCACTGGGTCTCGG -3'
Posted On2014-10-01