Mutagenetix > Incidental Mutation

Incidental Mutation 'R2152:Slc30a5'

234432

Institutional Source

Beutler Lab

Gene Symbol

Slc30a5

Ensembl Gene

ENSMUSG00000021629

Gene Name

solute carrier family 30 (zinc transporter), member 5

Synonyms

Zntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5

MMRRC Submission

040155-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.762) question?

Stock #

R2152 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100802648-100833427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100803949 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 619 (H619Q)

Ref Sequence

ENSEMBL: ENSMUSP00000153587 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]

AlphaFold

Q8R4H9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067246
AA Change: H676Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: H676Q

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
transmembrane domain	56	75	N/A	INTRINSIC
transmembrane domain	96	113	N/A	INTRINSIC
transmembrane domain	128	145	N/A	INTRINSIC
transmembrane domain	150	164	N/A	INTRINSIC
transmembrane domain	192	214	N/A	INTRINSIC
transmembrane domain	235	254	N/A	INTRINSIC
transmembrane domain	264	286	N/A	INTRINSIC
transmembrane domain	299	321	N/A	INTRINSIC
transmembrane domain	341	360	N/A	INTRINSIC
Pfam:Cation_efflux	417	645	1.9e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000225086

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225129

Predicted Effect

probably damaging
Transcript: ENSMUST00000225922
AA Change: H619Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.4859

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,934	D298V	probably damaging	Het
Ackr3	A	T	1: 90,213,843	Y8F	probably benign	Het
Acy1	T	C	9: 106,435,617	E175G	probably damaging	Het
Add2	T	C	6: 86,098,598	L243P	probably damaging	Het
Adsl	A	G	15: 80,967,662	D407G	probably damaging	Het
Afg3l1	T	G	8: 123,494,836	I478S	probably damaging	Het
Arfrp1	T	C	2: 181,359,694	T108A	probably benign	Het
Art5	A	G	7: 102,098,200	L124P	possibly damaging	Het
Asap2	A	T	12: 21,112,083	T14S	probably damaging	Het
Atp2c2	A	G	8: 119,756,102	N901S	probably benign	Het
Bbs12	G	T	3: 37,321,160	E586*	probably null	Het
Bicd2	G	T	13: 49,379,576	C546F	probably damaging	Het
Bid	A	T	6: 120,900,254	L42Q	probably damaging	Het
Bpifb9a	A	G	2: 154,260,135	K51E	probably benign	Het
Calcr	G	T	6: 3,687,615	T424K	probably benign	Het
Cd46	A	G	1: 195,062,413	I339T	probably benign	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cntn3	A	G	6: 102,206,537	I719T	probably damaging	Het
Cyb5r1	T	C	1: 134,409,625	I163T	possibly damaging	Het
Cyp2d26	A	T	15: 82,792,706		probably null	Het
Dclk1	A	G	3: 55,247,212	Y21C	probably damaging	Het
Dgcr2	G	A	16: 17,891,487		probably null	Het
Dhx38	T	C	8: 109,560,674	S221G	probably benign	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dnah3	C	T	7: 119,952,013	V3028I	probably benign	Het
Dnah6	T	C	6: 73,049,166	Y3448C	probably benign	Het
Dok5	G	A	2: 170,800,896	G38D	probably damaging	Het
Doxl2	T	A	6: 48,976,539	I466N	probably damaging	Het
Epb41l1	A	G	2: 156,514,128	D528G	probably damaging	Het
Fat4	A	T	3: 38,983,395	Y3732F	probably damaging	Het
Fgfr4	A	T	13: 55,166,964	Y640F	probably damaging	Het
Foxo6	T	A	4: 120,268,614	D328V	probably benign	Het
Foxp1	A	G	6: 99,016,541	L134P	probably damaging	Het
Frem2	G	A	3: 53,517,029	R2996*	probably null	Het
Fuk	T	A	8: 110,889,072	T542S	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gcn1l1	T	A	5: 115,609,829	I1765N	probably benign	Het
Gm4787	T	A	12: 81,377,219	I722F	probably benign	Het
Gpc6	G	T	14: 116,926,092	A53S	probably benign	Het
Gtpbp8	A	G	16: 44,740,027		probably null	Het
H2-Q2	T	C	17: 35,345,276		probably null	Het
Hapln2	C	A	3: 88,023,613	R157L	probably benign	Het
Hemgn	C	A	4: 46,396,607	E210*	probably null	Het
Hpse	T	A	5: 100,691,403	K360*	probably null	Het
Iqcj	A	T	3: 68,055,310	E68V	probably damaging	Het
Kat2a	T	C	11: 100,712,346		probably benign	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kcnab1	A	T	3: 65,371,440	I371F	probably damaging	Het
Klhl30	C	A	1: 91,357,824	A356D	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Micu1	G	T	10: 59,863,288	M468I	probably benign	Het
Mrc1	A	G	2: 14,327,864	T1292A	probably damaging	Het
Myh8	G	A	11: 67,294,469	E849K	probably damaging	Het
Myom3	G	T	4: 135,803,233	R1152L	probably benign	Het
Nedd4l	T	A	18: 65,210,330	H820Q	probably damaging	Het
Nlrp4g	T	A	9: 124,353,339		noncoding transcript	Het
Olfr1339	C	T	4: 118,735,249	A240V	possibly damaging	Het
Olfr1413	T	C	1: 92,573,908	S246P	probably damaging	Het
Olfr24	T	C	9: 18,755,095	D180G	probably damaging	Het
Olfr33	G	T	7: 102,713,581	H277Q	probably benign	Het
Olfr435	A	G	6: 43,202,069	I142V	probably benign	Het
Olfr592	A	T	7: 103,186,640	D13V	probably benign	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Olfr969	A	T	9: 39,795,647	I91F	probably benign	Het
Otop1	T	A	5: 38,302,851	M587K	probably damaging	Het
Pgm5	T	A	19: 24,834,815	I118F	probably damaging	Het
Phc2	A	G	4: 128,745,066	*41W	probably null	Het
Piezo2	A	T	18: 63,114,041	M532K	probably damaging	Het
Pjvk	A	T	2: 76,658,369	I295F	probably benign	Het
Popdc2	A	G	16: 38,363,120	N155S	possibly damaging	Het
Ppp4r3a	G	T	12: 101,042,567	N684K	probably damaging	Het
Prpf4b	T	A	13: 34,900,419	M930K	probably benign	Het
Ptpn12	C	A	5: 21,002,468	Q297H	probably damaging	Het
Ptprz1	C	A	6: 23,030,671	L1010I	probably damaging	Het
Rabepk	A	T	2: 34,784,550	D232E	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,985	H636R	probably benign	Het
Rb1	T	C	14: 73,288,725	T169A	probably benign	Het
Rcc2	T	C	4: 140,717,117	L373P	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rrbp1	A	G	2: 143,954,198	L1200P	possibly damaging	Het
Sdk1	A	G	5: 141,792,944	N226D	probably damaging	Het
Selenbp1	G	A	3: 94,944,130	R398H	probably damaging	Het
Selenoo	A	G	15: 89,099,282	M509V	probably benign	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc2a5	T	G	4: 150,125,638	S27A	probably damaging	Het
Slc5a9	A	G	4: 111,893,223	I146T	possibly damaging	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Snx29	A	G	16: 11,400,843	D181G	possibly damaging	Het
Spata31d1c	G	A	13: 65,033,965		probably null	Het
Stat5a	C	A	11: 100,874,090	T213N	probably benign	Het
Stt3a	A	T	9: 36,747,996	V349D	probably damaging	Het
Tcf20	A	T	15: 82,855,602	D549E	probably damaging	Het
Thbs2	T	A	17: 14,673,209	D903V	probably damaging	Het
Tln2	T	C	9: 67,302,560	T432A	probably damaging	Het
Tmc1	A	T	19: 20,856,675	N241K	probably benign	Het
Tmem260	G	T	14: 48,477,609	R240L	possibly damaging	Het
Tnfaip6	A	T	2: 52,043,730	E32D	probably damaging	Het
Trpa1	A	T	1: 14,899,401	H381Q	probably damaging	Het
Tsen2	T	C	6: 115,547,975	I45T	possibly damaging	Het
Ttc6	G	A	12: 57,705,552	V1415I	probably damaging	Het
Ttll7	G	T	3: 146,930,189	R426L	probably damaging	Het
Ttn	A	C	2: 76,740,138	S26804A	probably damaging	Het
Ubqlnl	A	T	7: 104,148,683	C536S	probably benign	Het
Vmn2r73	A	G	7: 85,857,728	V792A	probably benign	Het
Zfp345	T	C	2: 150,472,658	T320A	probably benign	Het
Zfp407	T	C	18: 84,209,649	D1945G	possibly damaging	Het

Other mutations in Slc30a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Slc30a5	APN	13	100806666	missense	probably damaging	1.00
IGL01647:Slc30a5	APN	13	100821145	missense	possibly damaging	0.66
IGL02338:Slc30a5	APN	13	100803433	missense	probably damaging	0.99
IGL02408:Slc30a5	APN	13	100813724	missense	probably damaging	1.00
IGL02582:Slc30a5	APN	13	100812647	critical splice donor site	probably null
IGL02987:Slc30a5	APN	13	100803915	missense	probably damaging	1.00
IGL03025:Slc30a5	APN	13	100813887	missense	probably damaging	0.99
IGL03064:Slc30a5	APN	13	100811310	missense	probably damaging	1.00
IGL03089:Slc30a5	APN	13	100813830	missense	probably benign	0.01
IGL03268:Slc30a5	APN	13	100806703	missense	probably damaging	1.00
R0083:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0108:Slc30a5	UTSW	13	100803400	missense	probably damaging	1.00
R0153:Slc30a5	UTSW	13	100826494	missense	possibly damaging	0.46
R0542:Slc30a5	UTSW	13	100809285	splice site	probably null
R0601:Slc30a5	UTSW	13	100814770	intron	probably benign
R1125:Slc30a5	UTSW	13	100803413	missense	probably damaging	1.00
R1434:Slc30a5	UTSW	13	100803442	missense	probably damaging	0.98
R1673:Slc30a5	UTSW	13	100813383	missense	probably benign	0.13
R1762:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R1974:Slc30a5	UTSW	13	100813953	missense	probably benign	0.06
R2082:Slc30a5	UTSW	13	100806533	critical splice donor site	probably null
R2151:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R2153:Slc30a5	UTSW	13	100803949	missense	probably damaging	1.00
R3899:Slc30a5	UTSW	13	100818147	missense	probably benign	0.18
R4009:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4010:Slc30a5	UTSW	13	100809233	missense	probably damaging	1.00
R4270:Slc30a5	UTSW	13	100829013	missense	probably benign	0.04
R4815:Slc30a5	UTSW	13	100813710	missense	probably damaging	1.00
R5048:Slc30a5	UTSW	13	100806741	missense	probably damaging	1.00
R5450:Slc30a5	UTSW	13	100821172	missense	possibly damaging	0.81
R5638:Slc30a5	UTSW	13	100813872	nonsense	probably null
R5892:Slc30a5	UTSW	13	100813302	missense	probably damaging	1.00
R5911:Slc30a5	UTSW	13	100809092	missense	probably damaging	1.00
R6453:Slc30a5	UTSW	13	100814689	missense	probably benign	0.00
R6769:Slc30a5	UTSW	13	100813860	missense	probably benign	0.19
R6795:Slc30a5	UTSW	13	100817069	missense	probably damaging	1.00
R7020:Slc30a5	UTSW	13	100824913	splice site	probably null
R7224:Slc30a5	UTSW	13	100809254	missense	probably damaging	0.99
R7305:Slc30a5	UTSW	13	100811424	missense	probably damaging	0.98
R7318:Slc30a5	UTSW	13	100813969	missense	probably benign	0.13
R7411:Slc30a5	UTSW	13	100818180	missense	probably benign	0.15
R7563:Slc30a5	UTSW	13	100803972	missense	probably benign	0.30
R8039:Slc30a5	UTSW	13	100813681	critical splice donor site	probably null
R8061:Slc30a5	UTSW	13	100828911	missense	probably damaging	0.99
R8973:Slc30a5	UTSW	13	100806694	missense	probably damaging	0.99
R9150:Slc30a5	UTSW	13	100803407	nonsense	probably null
R9352:Slc30a5	UTSW	13	100803872	missense	probably benign	0.10
R9359:Slc30a5	UTSW	13	100813462	missense	probably damaging	1.00
R9405:Slc30a5	UTSW	13	100813908	missense	probably benign	0.00
R9407:Slc30a5	UTSW	13	100814706	nonsense	probably null
R9628:Slc30a5	UTSW	13	100824914	critical splice donor site	probably null
X0019:Slc30a5	UTSW	13	100813842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTGTAACCTGTTAAGACATTCAG -3'
(R):5'- GCTCATTAAATACGCTCAGGAAAC -3'

Sequencing Primer
(F):5'- CCTGTCTACAAAGTGAGTTCCAGG -3'
(R):5'- TACGCTCAGGAAACAGAATAAATG -3'

Posted On

2014-10-01