Incidental Mutation 'R0196:Usp28'
ID23444
Institutional Source Beutler Lab
Gene Symbol Usp28
Ensembl Gene ENSMUSG00000032267
Gene Nameubiquitin specific peptidase 28
Synonyms9830148O20Rik
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0196 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location48985375-49042517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49028278 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 655 (D655G)
Ref Sequence ENSEMBL: ENSMUSP00000047467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215856]
Predicted Effect probably damaging
Transcript: ENSMUST00000047349
AA Change: D655G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: D655G

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213457
Predicted Effect possibly damaging
Transcript: ENSMUST00000213874
AA Change: D630G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215850
Predicted Effect possibly damaging
Transcript: ENSMUST00000215856
AA Change: D278G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Usp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Usp28 APN 9 49028163 missense probably benign 0.01
IGL01105:Usp28 APN 9 49010250 missense probably damaging 1.00
IGL01124:Usp28 APN 9 49037213 missense probably damaging 1.00
IGL01304:Usp28 APN 9 49026819 missense probably damaging 0.99
IGL01527:Usp28 APN 9 49025873 missense probably benign 0.02
IGL01859:Usp28 APN 9 49024021 nonsense probably null
IGL01860:Usp28 APN 9 49032243 nonsense probably null
IGL02047:Usp28 APN 9 49035641 missense probably damaging 0.99
IGL02188:Usp28 APN 9 49024009 missense probably benign 0.00
IGL02267:Usp28 APN 9 49023965 missense probably damaging 1.00
IGL02472:Usp28 APN 9 49037769 missense possibly damaging 0.95
IGL02675:Usp28 APN 9 49039091 missense possibly damaging 0.81
IGL02982:Usp28 APN 9 49018439 missense probably benign 0.00
IGL03105:Usp28 APN 9 49039055 missense probably damaging 0.99
R0100:Usp28 UTSW 9 49035932 missense probably damaging 1.00
R0114:Usp28 UTSW 9 49039023 missense probably benign 0.00
R0206:Usp28 UTSW 9 49028269 missense probably damaging 1.00
R0349:Usp28 UTSW 9 49010281 nonsense probably null
R0379:Usp28 UTSW 9 49024067 missense possibly damaging 0.58
R0454:Usp28 UTSW 9 49039101 missense possibly damaging 0.94
R0479:Usp28 UTSW 9 49037213 missense probably damaging 1.00
R0540:Usp28 UTSW 9 49024060 missense probably benign
R0726:Usp28 UTSW 9 49003869 missense probably damaging 1.00
R0835:Usp28 UTSW 9 49001524 missense probably damaging 1.00
R0928:Usp28 UTSW 9 49030891 missense possibly damaging 0.60
R1271:Usp28 UTSW 9 49035961 critical splice donor site probably null
R1534:Usp28 UTSW 9 48985506 missense possibly damaging 0.92
R1539:Usp28 UTSW 9 49037796 missense probably benign 0.07
R1687:Usp28 UTSW 9 49024017 missense probably benign 0.00
R1867:Usp28 UTSW 9 49009194 missense probably benign 0.00
R1868:Usp28 UTSW 9 49016707 missense probably damaging 1.00
R1884:Usp28 UTSW 9 49035947 missense probably damaging 1.00
R2029:Usp28 UTSW 9 48985503 missense probably benign 0.22
R2046:Usp28 UTSW 9 49039075 missense probably damaging 1.00
R2379:Usp28 UTSW 9 49003095 missense probably null 0.94
R2404:Usp28 UTSW 9 49037258 critical splice donor site probably null
R3196:Usp28 UTSW 9 49025825 missense probably benign 0.03
R3831:Usp28 UTSW 9 49035638 missense probably benign 0.00
R3922:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3924:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3926:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3943:Usp28 UTSW 9 49000366 missense probably benign 0.12
R4834:Usp28 UTSW 9 49001536 missense probably damaging 1.00
R5041:Usp28 UTSW 9 49037773 missense probably benign
R5186:Usp28 UTSW 9 49010250 missense probably damaging 1.00
R5308:Usp28 UTSW 9 49037201 missense probably damaging 1.00
R5870:Usp28 UTSW 9 49025985 nonsense probably null
R6838:Usp28 UTSW 9 49000430 critical splice donor site probably null
R6959:Usp28 UTSW 9 49001542 missense probably damaging 1.00
R7058:Usp28 UTSW 9 49039156 missense probably damaging 1.00
R7348:Usp28 UTSW 9 49030877 missense probably benign 0.19
R7766:Usp28 UTSW 9 49035883 missense probably damaging 1.00
R7814:Usp28 UTSW 9 49003918 missense probably benign 0.01
R7828:Usp28 UTSW 9 49003902 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGCTTACATGCAGTTCTTGTTCACG -3'
(R):5'- ACATCACAGAGGGTGGTTGGTTTC -3'

Sequencing Primer
(F):5'- TTGTTCACGAAGGACAAGCC -3'
(R):5'- GGTTTCTGACTATTTGAGACATTTTC -3'
Posted On2013-04-16