Mutagenetix > Incidental Mutations

Incidental Mutation 'R0196:Usp28'

23444

Institutional Source

Beutler Lab

Gene Symbol

Usp28

Ensembl Gene

ENSMUSG00000032267

Gene Name

ubiquitin specific peptidase 28

Synonyms

9830148O20Rik

MMRRC Submission

038455-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48985375-49042517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49028278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 655 (D655G)

Ref Sequence

ENSEMBL: ENSMUSP00000047467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215856]

AlphaFold

Q5I043

Predicted Effect

probably damaging
Transcript: ENSMUST00000047349
AA Change: D655G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: D655G

Domain	Start	End	E-Value	Type
UIM	97	116	3.1e-3	SMART
Pfam:UCH	161	652	5.4e-52	PFAM
Pfam:UCH_1	162	626	2e-11	PFAM
low complexity region	695	705	N/A	INTRINSIC
low complexity region	713	730	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213457

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213874
AA Change: D630G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215118

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215378

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215850

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215856
AA Change: D278G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Usp28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Usp28	APN	9	49028163	missense	probably benign	0.01
IGL01105:Usp28	APN	9	49010250	missense	probably damaging	1.00
IGL01124:Usp28	APN	9	49037213	missense	probably damaging	1.00
IGL01304:Usp28	APN	9	49026819	missense	probably damaging	0.99
IGL01527:Usp28	APN	9	49025873	missense	probably benign	0.02
IGL01859:Usp28	APN	9	49024021	nonsense	probably null
IGL01860:Usp28	APN	9	49032243	nonsense	probably null
IGL02047:Usp28	APN	9	49035641	missense	probably damaging	0.99
IGL02188:Usp28	APN	9	49024009	missense	probably benign	0.00
IGL02267:Usp28	APN	9	49023965	missense	probably damaging	1.00
IGL02472:Usp28	APN	9	49037769	missense	possibly damaging	0.95
IGL02675:Usp28	APN	9	49039091	missense	possibly damaging	0.81
IGL02982:Usp28	APN	9	49018439	missense	probably benign	0.00
IGL03105:Usp28	APN	9	49039055	missense	probably damaging	0.99
R0100:Usp28	UTSW	9	49035932	missense	probably damaging	1.00
R0114:Usp28	UTSW	9	49039023	missense	probably benign	0.00
R0206:Usp28	UTSW	9	49028269	missense	probably damaging	1.00
R0349:Usp28	UTSW	9	49010281	nonsense	probably null
R0379:Usp28	UTSW	9	49024067	missense	possibly damaging	0.58
R0454:Usp28	UTSW	9	49039101	missense	possibly damaging	0.94
R0479:Usp28	UTSW	9	49037213	missense	probably damaging	1.00
R0540:Usp28	UTSW	9	49024060	missense	probably benign
R0726:Usp28	UTSW	9	49003869	missense	probably damaging	1.00
R0835:Usp28	UTSW	9	49001524	missense	probably damaging	1.00
R0928:Usp28	UTSW	9	49030891	missense	possibly damaging	0.60
R1271:Usp28	UTSW	9	49035961	critical splice donor site	probably null
R1534:Usp28	UTSW	9	48985506	missense	possibly damaging	0.92
R1539:Usp28	UTSW	9	49037796	missense	probably benign	0.07
R1687:Usp28	UTSW	9	49024017	missense	probably benign	0.00
R1867:Usp28	UTSW	9	49009194	missense	probably benign	0.00
R1868:Usp28	UTSW	9	49016707	missense	probably damaging	1.00
R1884:Usp28	UTSW	9	49035947	missense	probably damaging	1.00
R2029:Usp28	UTSW	9	48985503	missense	probably benign	0.22
R2046:Usp28	UTSW	9	49039075	missense	probably damaging	1.00
R2379:Usp28	UTSW	9	49003095	missense	probably null	0.94
R2404:Usp28	UTSW	9	49037258	critical splice donor site	probably null
R3196:Usp28	UTSW	9	49025825	missense	probably benign	0.03
R3831:Usp28	UTSW	9	49035638	missense	probably benign	0.00
R3922:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3924:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3926:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3943:Usp28	UTSW	9	49000366	missense	probably benign	0.12
R4834:Usp28	UTSW	9	49001536	missense	probably damaging	1.00
R5041:Usp28	UTSW	9	49037773	missense	probably benign
R5186:Usp28	UTSW	9	49010250	missense	probably damaging	1.00
R5308:Usp28	UTSW	9	49037201	missense	probably damaging	1.00
R5870:Usp28	UTSW	9	49025985	nonsense	probably null
R6838:Usp28	UTSW	9	49000430	critical splice donor site	probably null
R6959:Usp28	UTSW	9	49001542	missense	probably damaging	1.00
R7058:Usp28	UTSW	9	49039156	missense	probably damaging	1.00
R7348:Usp28	UTSW	9	49030877	missense	probably benign	0.19
R7766:Usp28	UTSW	9	49035883	missense	probably damaging	1.00
R7814:Usp28	UTSW	9	49003918	missense	probably benign	0.01
R7828:Usp28	UTSW	9	49003902	missense	possibly damaging	0.95
R8167:Usp28	UTSW	9	49037848	missense	probably damaging	0.99
R8226:Usp28	UTSW	9	49015397	splice site	probably null
R8273:Usp28	UTSW	9	49026882	missense	probably damaging	1.00
R8972:Usp28	UTSW	9	49037824	missense	probably null	0.83
R8998:Usp28	UTSW	9	49037839	missense	probably benign
R9312:Usp28	UTSW	9	49015139	nonsense	probably null
Z1176:Usp28	UTSW	9	49035925	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGCTTACATGCAGTTCTTGTTCACG -3'
(R):5'- ACATCACAGAGGGTGGTTGGTTTC -3'

Sequencing Primer
(F):5'- TTGTTCACGAAGGACAAGCC -3'
(R):5'- GGTTTCTGACTATTTGAGACATTTTC -3'

Posted On

2013-04-16