Incidental Mutation 'R2152:Adsl'
ID234441
Institutional Source Beutler Lab
Gene Symbol Adsl
Ensembl Gene ENSMUSG00000022407
Gene Nameadenylosuccinate lyase
Synonyms
MMRRC Submission 040155-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2152 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80948490-80970946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80967662 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 407 (D407G)
Ref Sequence ENSEMBL: ENSMUSP00000127593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023043] [ENSMUST00000164806] [ENSMUST00000166711] [ENSMUST00000168756] [ENSMUST00000169238] [ENSMUST00000200201] [ENSMUST00000207170]
Predicted Effect probably damaging
Transcript: ENSMUST00000023043
AA Change: D422G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023043
Gene: ENSMUSG00000022407
AA Change: D422G

DomainStartEndE-ValueType
Pfam:Lyase_1 49 313 4.4e-29 PFAM
ADSL_C 377 461 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163575
Predicted Effect probably benign
Transcript: ENSMUST00000164806
SMART Domains Protein: ENSMUSP00000131998
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
Pfam:Lyase_1 47 313 8.4e-29 PFAM
Blast:ADSL_C 377 416 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166711
SMART Domains Protein: ENSMUSP00000129601
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168756
AA Change: D407G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127593
Gene: ENSMUSG00000022407
AA Change: D407G

DomainStartEndE-ValueType
Pfam:Lyase_1 115 298 3.9e-25 PFAM
ADSL_C 362 446 5.65e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169238
SMART Domains Protein: ENSMUSP00000132423
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199284
Predicted Effect probably benign
Transcript: ENSMUST00000200201
SMART Domains Protein: ENSMUSP00000143188
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 119 6e-77 PDB
SCOP:d1c3ca_ 20 119 4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207170
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in adenosine monophosphate (AMP) biosynthesis and maintaining AMP levels in the muscle. The encoded enzyme catalyzes the release of fumarate during AMP biosynthesis by cleaving the substrates succinylaminoimidazole carboxamide (SAICA) ribotide to give aminoimidazole carboxamide (AICA) ribotide, and adenylosuccinate to give adenylate. In humans, this gene is associated with adenylosuccinate deficiency, a rare autosomal disorder resulting in a spectrum of neurological symptoms. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,934 D298V probably damaging Het
Ackr3 A T 1: 90,213,843 Y8F probably benign Het
Acy1 T C 9: 106,435,617 E175G probably damaging Het
Add2 T C 6: 86,098,598 L243P probably damaging Het
Afg3l1 T G 8: 123,494,836 I478S probably damaging Het
Arfrp1 T C 2: 181,359,694 T108A probably benign Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bbs12 G T 3: 37,321,160 E586* probably null Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Bid A T 6: 120,900,254 L42Q probably damaging Het
Bpifb9a A G 2: 154,260,135 K51E probably benign Het
Calcr G T 6: 3,687,615 T424K probably benign Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntn3 A G 6: 102,206,537 I719T probably damaging Het
Cyb5r1 T C 1: 134,409,625 I163T possibly damaging Het
Cyp2d26 A T 15: 82,792,706 probably null Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dgcr2 G A 16: 17,891,487 probably null Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dnah3 C T 7: 119,952,013 V3028I probably benign Het
Dnah6 T C 6: 73,049,166 Y3448C probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Doxl2 T A 6: 48,976,539 I466N probably damaging Het
Epb41l1 A G 2: 156,514,128 D528G probably damaging Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fgfr4 A T 13: 55,166,964 Y640F probably damaging Het
Foxo6 T A 4: 120,268,614 D328V probably benign Het
Foxp1 A G 6: 99,016,541 L134P probably damaging Het
Frem2 G A 3: 53,517,029 R2996* probably null Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gcn1l1 T A 5: 115,609,829 I1765N probably benign Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gpc6 G T 14: 116,926,092 A53S probably benign Het
Gtpbp8 A G 16: 44,740,027 probably null Het
H2-Q2 T C 17: 35,345,276 probably null Het
Hapln2 C A 3: 88,023,613 R157L probably benign Het
Hemgn C A 4: 46,396,607 E210* probably null Het
Hpse T A 5: 100,691,403 K360* probably null Het
Iqcj A T 3: 68,055,310 E68V probably damaging Het
Kat2a T C 11: 100,712,346 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Klhl30 C A 1: 91,357,824 A356D probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Micu1 G T 10: 59,863,288 M468I probably benign Het
Mrc1 A G 2: 14,327,864 T1292A probably damaging Het
Myh8 G A 11: 67,294,469 E849K probably damaging Het
Myom3 G T 4: 135,803,233 R1152L probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 noncoding transcript Het
Olfr1339 C T 4: 118,735,249 A240V possibly damaging Het
Olfr1413 T C 1: 92,573,908 S246P probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr33 G T 7: 102,713,581 H277Q probably benign Het
Olfr435 A G 6: 43,202,069 I142V probably benign Het
Olfr592 A T 7: 103,186,640 D13V probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Olfr969 A T 9: 39,795,647 I91F probably benign Het
Otop1 T A 5: 38,302,851 M587K probably damaging Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phc2 A G 4: 128,745,066 *41W probably null Het
Piezo2 A T 18: 63,114,041 M532K probably damaging Het
Pjvk A T 2: 76,658,369 I295F probably benign Het
Popdc2 A G 16: 38,363,120 N155S possibly damaging Het
Ppp4r3a G T 12: 101,042,567 N684K probably damaging Het
Prpf4b T A 13: 34,900,419 M930K probably benign Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Ptprz1 C A 6: 23,030,671 L1010I probably damaging Het
Rabepk A T 2: 34,784,550 D232E possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rb1 T C 14: 73,288,725 T169A probably benign Het
Rcc2 T C 4: 140,717,117 L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Sdk1 A G 5: 141,792,944 N226D probably damaging Het
Selenbp1 G A 3: 94,944,130 R398H probably damaging Het
Selenoo A G 15: 89,099,282 M509V probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc2a5 T G 4: 150,125,638 S27A probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slc5a9 A G 4: 111,893,223 I146T possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Snx29 A G 16: 11,400,843 D181G possibly damaging Het
Spata31d1c G A 13: 65,033,965 probably null Het
Stat5a C A 11: 100,874,090 T213N probably benign Het
Stt3a A T 9: 36,747,996 V349D probably damaging Het
Tcf20 A T 15: 82,855,602 D549E probably damaging Het
Thbs2 T A 17: 14,673,209 D903V probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmc1 A T 19: 20,856,675 N241K probably benign Het
Tmem260 G T 14: 48,477,609 R240L possibly damaging Het
Tnfaip6 A T 2: 52,043,730 E32D probably damaging Het
Trpa1 A T 1: 14,899,401 H381Q probably damaging Het
Tsen2 T C 6: 115,547,975 I45T possibly damaging Het
Ttc6 G A 12: 57,705,552 V1415I probably damaging Het
Ttll7 G T 3: 146,930,189 R426L probably damaging Het
Ttn A C 2: 76,740,138 S26804A probably damaging Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn2r73 A G 7: 85,857,728 V792A probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Adsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Adsl APN 15 80948700 missense probably null 0.24
IGL02249:Adsl APN 15 80960475 missense probably benign 0.26
IGL03009:Adsl APN 15 80952243 nonsense probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0194:Adsl UTSW 15 80961360 missense possibly damaging 0.91
R0575:Adsl UTSW 15 80963685 missense probably damaging 1.00
R1111:Adsl UTSW 15 80967660 missense probably damaging 1.00
R1606:Adsl UTSW 15 80952224 nonsense probably null
R1822:Adsl UTSW 15 80962742 nonsense probably null
R2284:Adsl UTSW 15 80963895 missense probably damaging 0.99
R4008:Adsl UTSW 15 80966156 missense probably benign 0.05
R4010:Adsl UTSW 15 80966156 missense probably benign 0.05
R4011:Adsl UTSW 15 80966156 missense probably benign 0.05
R4202:Adsl UTSW 15 80952216 missense probably damaging 0.98
R4587:Adsl UTSW 15 80967767 critical splice donor site probably null
R5053:Adsl UTSW 15 80960450 missense probably damaging 1.00
R5086:Adsl UTSW 15 80963700 missense probably damaging 0.96
R5123:Adsl UTSW 15 80952294 unclassified probably null
R5187:Adsl UTSW 15 80948905 intron probably benign
R5416:Adsl UTSW 15 80952183 splice site probably null
R5532:Adsl UTSW 15 80963909 missense probably damaging 1.00
R5898:Adsl UTSW 15 80961353 splice site probably null
R7401:Adsl UTSW 15 80962782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGAATCGCCTGCACAGC -3'
(R):5'- ACTCTTGCATCCTTGGGGTAG -3'

Sequencing Primer
(F):5'- ACAGCAGGGCAGGTTCTG -3'
(R):5'- TATGGATGCATGCAACCTCG -3'
Posted On2014-10-01