Incidental Mutation 'R2152:Nedd4l'
ID 234455
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 040155-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R2152 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65343401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 820 (H820Q)
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: H820Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: H820Q

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: H941Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: H941Q

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: H800Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: H820Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr3 A T 1: 90,141,565 (GRCm39) Y8F probably benign Het
Acy1 T C 9: 106,312,816 (GRCm39) E175G probably damaging Het
Add2 T C 6: 86,075,580 (GRCm39) L243P probably damaging Het
Adsl A G 15: 80,851,863 (GRCm39) D407G probably damaging Het
Afg3l1 T G 8: 124,221,575 (GRCm39) I478S probably damaging Het
Aoc1l1 T A 6: 48,953,473 (GRCm39) I466N probably damaging Het
Arfrp1 T C 2: 181,001,487 (GRCm39) T108A probably benign Het
Art5 A G 7: 101,747,407 (GRCm39) L124P possibly damaging Het
Asap2 A T 12: 21,162,084 (GRCm39) T14S probably damaging Het
Atp2c2 A G 8: 120,482,841 (GRCm39) N901S probably benign Het
Bbs12 G T 3: 37,375,309 (GRCm39) E586* probably null Het
Bicd2 G T 13: 49,533,052 (GRCm39) C546F probably damaging Het
Bid A T 6: 120,877,215 (GRCm39) L42Q probably damaging Het
Bpifb9a A G 2: 154,102,055 (GRCm39) K51E probably benign Het
Calcr G T 6: 3,687,615 (GRCm39) T424K probably benign Het
Cd46 A G 1: 194,744,721 (GRCm39) I339T probably benign Het
Chek1 C A 9: 36,635,279 (GRCm39) V35F probably damaging Het
Cntn3 A G 6: 102,183,498 (GRCm39) I719T probably damaging Het
Cyb5r1 T C 1: 134,337,363 (GRCm39) I163T possibly damaging Het
Cyp2d26 A T 15: 82,676,907 (GRCm39) probably null Het
Dclk1 A G 3: 55,154,633 (GRCm39) Y21C probably damaging Het
Dgcr2 G A 16: 17,709,351 (GRCm39) probably null Het
Dhx38 T C 8: 110,287,306 (GRCm39) S221G probably benign Het
Dis3l T A 9: 64,214,545 (GRCm39) N981I probably benign Het
Dnah3 C T 7: 119,551,236 (GRCm39) V3028I probably benign Het
Dnah6 T C 6: 73,026,149 (GRCm39) Y3448C probably benign Het
Dok5 G A 2: 170,642,816 (GRCm39) G38D probably damaging Het
Epb41l1 A G 2: 156,356,048 (GRCm39) D528G probably damaging Het
Fat4 A T 3: 39,037,544 (GRCm39) Y3732F probably damaging Het
Fcsk T A 8: 111,615,704 (GRCm39) T542S probably benign Het
Fgfr4 A T 13: 55,314,777 (GRCm39) Y640F probably damaging Het
Foxo6 T A 4: 120,125,811 (GRCm39) D328V probably benign Het
Foxp1 A G 6: 98,993,502 (GRCm39) L134P probably damaging Het
Frem2 G A 3: 53,424,450 (GRCm39) R2996* probably null Het
Garem2 T C 5: 30,313,297 (GRCm39) S54P probably damaging Het
Gcn1 T A 5: 115,747,888 (GRCm39) I1765N probably benign Het
Gm4787 T A 12: 81,423,993 (GRCm39) I722F probably benign Het
Gpc6 G T 14: 117,163,504 (GRCm39) A53S probably benign Het
Gtpbp8 A G 16: 44,560,390 (GRCm39) probably null Het
H2-Q2 T C 17: 35,564,252 (GRCm39) probably null Het
Hapln2 C A 3: 87,930,920 (GRCm39) R157L probably benign Het
Hemgn C A 4: 46,396,607 (GRCm39) E210* probably null Het
Hpse T A 5: 100,839,269 (GRCm39) K360* probably null Het
Iqcj A T 3: 67,962,643 (GRCm39) E68V probably damaging Het
Kat2a T C 11: 100,603,172 (GRCm39) probably benign Het
Kat6b A T 14: 21,718,735 (GRCm39) H1138L probably benign Het
Kcnab1 A T 3: 65,278,861 (GRCm39) I371F probably damaging Het
Klhl30 C A 1: 91,285,546 (GRCm39) A356D probably benign Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Micu1 G T 10: 59,699,110 (GRCm39) M468I probably benign Het
Mrc1 A G 2: 14,332,675 (GRCm39) T1292A probably damaging Het
Myh8 G A 11: 67,185,295 (GRCm39) E849K probably damaging Het
Myom3 G T 4: 135,530,544 (GRCm39) R1152L probably benign Het
Nlrp4g T A 9: 124,353,339 (GRCm38) noncoding transcript Het
Oga A T 19: 45,746,461 (GRCm39) Y779* probably null Het
Or13p5 C T 4: 118,592,446 (GRCm39) A240V possibly damaging Het
Or1m1 T C 9: 18,666,391 (GRCm39) D180G probably damaging Het
Or2a51 A G 6: 43,179,003 (GRCm39) I142V probably benign Het
Or51a39 G T 7: 102,362,788 (GRCm39) H277Q probably benign Het
Or52j3 A T 7: 102,835,847 (GRCm39) D13V probably benign Het
Or8b49 G T 9: 38,505,707 (GRCm39) L63F probably damaging Het
Or8g54 A T 9: 39,706,943 (GRCm39) I91F probably benign Het
Or9s23 T C 1: 92,501,630 (GRCm39) S246P probably damaging Het
Otop1 T A 5: 38,460,194 (GRCm39) M587K probably damaging Het
Pgm5 T A 19: 24,812,179 (GRCm39) I118F probably damaging Het
Phc2 A G 4: 128,638,859 (GRCm39) *41W probably null Het
Phf8-ps T A 17: 33,285,908 (GRCm39) D298V probably damaging Het
Piezo2 A T 18: 63,247,112 (GRCm39) M532K probably damaging Het
Pjvk A T 2: 76,488,713 (GRCm39) I295F probably benign Het
Popdc2 A G 16: 38,183,482 (GRCm39) N155S possibly damaging Het
Ppp4r3a G T 12: 101,008,826 (GRCm39) N684K probably damaging Het
Prpf4b T A 13: 35,084,402 (GRCm39) M930K probably benign Het
Ptpn12 C A 5: 21,207,466 (GRCm39) Q297H probably damaging Het
Ptprz1 C A 6: 23,030,670 (GRCm39) L1010I probably damaging Het
Rabepk A T 2: 34,674,562 (GRCm39) D232E possibly damaging Het
Rad51ap2 A G 12: 11,507,986 (GRCm39) H636R probably benign Het
Rb1 T C 14: 73,526,165 (GRCm39) T169A probably benign Het
Rcc2 T C 4: 140,444,428 (GRCm39) L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rrbp1 A G 2: 143,796,118 (GRCm39) L1200P possibly damaging Het
Sdk1 A G 5: 141,778,699 (GRCm39) N226D probably damaging Het
Selenbp1 G A 3: 94,851,441 (GRCm39) R398H probably damaging Het
Selenoo A G 15: 88,983,485 (GRCm39) M509V probably benign Het
Sidt2 T C 9: 45,856,638 (GRCm39) D477G probably damaging Het
Slc2a5 T G 4: 150,210,095 (GRCm39) S27A probably damaging Het
Slc30a5 A T 13: 100,940,457 (GRCm39) H619Q probably damaging Het
Slc5a9 A G 4: 111,750,420 (GRCm39) I146T possibly damaging Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Slmap A G 14: 26,139,402 (GRCm39) Y771H probably damaging Het
Snx29 A G 16: 11,218,707 (GRCm39) D181G possibly damaging Het
Spata31d1c G A 13: 65,181,779 (GRCm39) probably null Het
Stat5a C A 11: 100,764,916 (GRCm39) T213N probably benign Het
Stt3a A T 9: 36,659,292 (GRCm39) V349D probably damaging Het
Tcf20 A T 15: 82,739,803 (GRCm39) D549E probably damaging Het
Thbs2 T A 17: 14,893,471 (GRCm39) D903V probably damaging Het
Tln2 T C 9: 67,209,842 (GRCm39) T432A probably damaging Het
Tmc1 A T 19: 20,834,039 (GRCm39) N241K probably benign Het
Tmem260 G T 14: 48,715,066 (GRCm39) R240L possibly damaging Het
Tnfaip6 A T 2: 51,933,742 (GRCm39) E32D probably damaging Het
Trpa1 A T 1: 14,969,625 (GRCm39) H381Q probably damaging Het
Tsen2 T C 6: 115,524,936 (GRCm39) I45T possibly damaging Het
Ttc6 G A 12: 57,752,338 (GRCm39) V1415I probably damaging Het
Ttll7 G T 3: 146,635,944 (GRCm39) R426L probably damaging Het
Ttn A C 2: 76,570,482 (GRCm39) S26804A probably damaging Het
Ubqlnl A T 7: 103,797,890 (GRCm39) C536S probably benign Het
Vmn2r73 A G 7: 85,506,936 (GRCm39) V792A probably benign Het
Zfp345 T C 2: 150,314,578 (GRCm39) T320A probably benign Het
Zfp407 T C 18: 84,227,774 (GRCm39) D1945G possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTCCCACAGGACTCACC -3'
(R):5'- ATGCTCCCATGATGGCTTCAC -3'

Sequencing Primer
(F):5'- GCAGACCGCACTCTGAG -3'
(R):5'- GCATGCTCTGCCTACGTGTATG -3'
Posted On 2014-10-01