Incidental Mutation 'R2153:Stxbp1'
ID 234470
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Name syntaxin binding protein 1
Synonyms Munc-18a, Sxtbp1, N-sec1, nsec1, Munc18-1, Rb-sec1, Unc18h
MMRRC Submission 040156-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R2153 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 32677619-32737249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32692868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 383 (I383F)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458]
AlphaFold O08599
Predicted Effect probably damaging
Transcript: ENSMUST00000050000
AA Change: I383F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: I383F

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077458
AA Change: I383F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: I383F

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113222
SMART Domains Protein: ENSMUSP00000108848
Gene: ENSMUSG00000026797

DomainStartEndE-ValueType
Pfam:Sec1 1 419 1.7e-106 PFAM
Meta Mutation Damage Score 0.7092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,208,959 (GRCm39) E363G probably benign Het
Abcg2 T A 6: 58,661,307 (GRCm39) probably null Het
Adgrg7 T G 16: 56,572,791 (GRCm39) I342L possibly damaging Het
Akap6 A C 12: 53,188,187 (GRCm39) D1867A probably benign Het
Ankrd17 A T 5: 90,381,918 (GRCm39) V2416D probably damaging Het
Apaf1 A G 10: 90,883,952 (GRCm39) V670A probably damaging Het
Art5 A G 7: 101,747,407 (GRCm39) L124P possibly damaging Het
Atad5 T A 11: 79,997,203 (GRCm39) D842E probably benign Het
Brd10 T C 19: 29,694,229 (GRCm39) M1755V probably benign Het
Capns1 A G 7: 29,891,765 (GRCm39) L124P probably damaging Het
Carmil1 A G 13: 24,325,656 (GRCm39) S225P probably damaging Het
Cars2 C T 8: 11,580,299 (GRCm39) A247T possibly damaging Het
Cd46 A G 1: 194,744,721 (GRCm39) I339T probably benign Het
Ceacam14 C A 7: 17,548,153 (GRCm39) T81N probably benign Het
Ceacam16 G A 7: 19,595,066 (GRCm39) P4L probably benign Het
Chek1 C A 9: 36,635,279 (GRCm39) V35F probably damaging Het
Cntnap5c A T 17: 58,362,666 (GRCm39) I340L possibly damaging Het
Col2a1 C A 15: 97,885,461 (GRCm39) A461S unknown Het
Comtd1 T C 14: 21,898,340 (GRCm39) E27G possibly damaging Het
Cyp2a12 A G 7: 26,732,042 (GRCm39) N261S probably benign Het
Dclk1 A G 3: 55,154,633 (GRCm39) Y21C probably damaging Het
Dis3l T A 9: 64,214,545 (GRCm39) N981I probably benign Het
Dlg5 A T 14: 24,187,225 (GRCm39) I1819N probably damaging Het
Elp1 T A 4: 56,779,636 (GRCm39) probably null Het
Enpep T C 3: 129,074,231 (GRCm39) N772S probably damaging Het
Erich1 T C 8: 14,128,773 (GRCm39) T56A probably benign Het
Ermp1 T C 19: 29,614,798 (GRCm39) probably null Het
Etl4 A G 2: 20,803,545 (GRCm39) E807G probably benign Het
Fat4 A T 3: 39,037,544 (GRCm39) Y3732F probably damaging Het
Fbxw18 T G 9: 109,522,438 (GRCm39) T144P probably damaging Het
Flywch1 A T 17: 23,974,624 (GRCm39) I672K probably benign Het
Foxk2 C A 11: 121,151,213 (GRCm39) A86E probably benign Het
Garem2 T C 5: 30,313,297 (GRCm39) S54P probably damaging Het
Gda A G 19: 21,374,869 (GRCm39) probably null Het
Gna15 T C 10: 81,338,738 (GRCm39) Y367C probably damaging Het
Golga3 A G 5: 110,335,856 (GRCm39) probably null Het
Greb1 T C 12: 16,749,533 (GRCm39) S1098G probably damaging Het
Hook3 C A 8: 26,560,225 (GRCm39) L333F probably damaging Het
Il6 C T 5: 30,218,502 (GRCm39) Q33* probably null Het
Iqgap1 T C 7: 80,401,701 (GRCm39) E468G probably benign Het
Iqgap1 A G 7: 80,409,651 (GRCm39) I228T possibly damaging Het
Kat6b A T 14: 21,718,735 (GRCm39) H1138L probably benign Het
Kcnab1 A T 3: 65,278,861 (GRCm39) I371F probably damaging Het
Kcnj10 A T 1: 172,197,455 (GRCm39) Y323F possibly damaging Het
Klk1b5 T C 7: 43,869,322 (GRCm39) probably null Het
Lmo7 A G 14: 102,157,951 (GRCm39) probably benign Het
Loxhd1 A T 18: 77,443,862 (GRCm39) T277S possibly damaging Het
Lrp5 A T 19: 3,664,339 (GRCm39) M796K probably benign Het
Med15 A T 16: 17,503,315 (GRCm39) probably null Het
Mfn1 T A 3: 32,596,975 (GRCm39) H144Q probably damaging Het
Mmp25 T A 17: 23,850,048 (GRCm39) Y504F probably damaging Het
Nmi T C 2: 51,842,555 (GRCm39) E179G probably damaging Het
Nrxn2 T C 19: 6,554,944 (GRCm39) I1141T probably damaging Het
Olah T C 2: 3,366,306 (GRCm39) S9G probably benign Het
Or1m1 T C 9: 18,666,391 (GRCm39) D180G probably damaging Het
Or4c106 C A 2: 88,683,128 (GRCm39) P278H probably damaging Het
Or5b120 T G 19: 13,479,852 (GRCm39) I48M probably damaging Het
Or8b49 G T 9: 38,505,707 (GRCm39) L63F probably damaging Het
Or8k22 A C 2: 86,162,872 (GRCm39) F276C probably damaging Het
Otog T A 7: 45,952,328 (GRCm39) C2591S probably damaging Het
Pdgfrb G T 18: 61,205,828 (GRCm39) V605F probably damaging Het
Pik3cb T A 9: 98,983,297 (GRCm39) K104* probably null Het
Plb1 T A 5: 32,471,433 (GRCm39) I580N probably damaging Het
Plekha2 T C 8: 25,578,413 (GRCm39) Y29C probably damaging Het
Plekha7 T A 7: 115,775,002 (GRCm39) Y213F probably damaging Het
Plin5 T C 17: 56,423,836 (GRCm39) D33G probably benign Het
Pnpla2 C A 7: 141,039,132 (GRCm39) Q371K probably damaging Het
Ppm1n A G 7: 19,012,110 (GRCm39) Y348H probably damaging Het
Ppp2r1b T A 9: 50,777,854 (GRCm39) D266E probably damaging Het
Prss23 A G 7: 89,159,119 (GRCm39) S317P probably damaging Het
Prss33 C T 17: 24,053,817 (GRCm39) V87M probably damaging Het
Ptpn12 C A 5: 21,207,466 (GRCm39) Q297H probably damaging Het
Pum1 G T 4: 130,478,802 (GRCm39) A571S probably damaging Het
Rexo1 G T 10: 80,379,943 (GRCm39) C13* probably null Het
Rhpn1 A T 15: 75,576,243 (GRCm39) M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Ripk2 A G 4: 16,132,775 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,530,920 (GRCm39) Y937C probably damaging Het
Rrbp1 A G 2: 143,796,118 (GRCm39) L1200P possibly damaging Het
Ryr2 A G 13: 11,592,759 (GRCm39) I4665T possibly damaging Het
Sbno1 C A 5: 124,516,606 (GRCm39) V1256F probably benign Het
Senp5 T C 16: 31,787,692 (GRCm39) I644V probably damaging Het
Serpinb9e T A 13: 33,436,961 (GRCm39) F94I probably damaging Het
Sidt2 T C 9: 45,856,638 (GRCm39) D477G probably damaging Het
Slc30a5 A T 13: 100,940,457 (GRCm39) H619Q probably damaging Het
Slmap A G 14: 26,139,402 (GRCm39) Y771H probably damaging Het
Sned1 T A 1: 93,202,379 (GRCm39) D674E probably benign Het
Sorl1 T C 9: 41,895,788 (GRCm39) H1789R probably benign Het
Sp2 T C 11: 96,852,834 (GRCm39) D30G possibly damaging Het
Stk33 T A 7: 108,940,527 (GRCm39) N61I probably benign Het
Tbcd A G 11: 121,494,457 (GRCm39) Q1006R possibly damaging Het
Tln2 T C 9: 67,209,842 (GRCm39) T432A probably damaging Het
Tnfrsf21 A G 17: 43,398,763 (GRCm39) D623G probably damaging Het
Trib2 A G 12: 15,843,830 (GRCm39) F271L probably damaging Het
Ttn A G 2: 76,810,477 (GRCm39) V17A probably benign Het
Ubqlnl A T 7: 103,797,890 (GRCm39) C536S probably benign Het
Vmn1r230 T A 17: 21,067,063 (GRCm39) M84K probably damaging Het
Vmn2r97 A T 17: 19,167,584 (GRCm39) R613* probably null Het
Yeats2 T A 16: 19,972,916 (GRCm39) D23E probably damaging Het
Zan T A 5: 137,434,662 (GRCm39) I2214F unknown Het
Zbtb40 T C 4: 136,718,946 (GRCm39) D917G probably damaging Het
Zcchc2 C A 1: 105,949,453 (GRCm39) probably null Het
Zdhhc23 G T 16: 43,794,282 (GRCm39) Q131K probably benign Het
Zfp345 T C 2: 150,314,578 (GRCm39) T320A probably benign Het
Zfp532 A G 18: 65,757,998 (GRCm39) T644A possibly damaging Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32,702,076 (GRCm39) missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32,709,913 (GRCm39) missense probably damaging 0.98
volume UTSW 2 32,691,905 (GRCm39) missense probably damaging 0.99
volume2 UTSW 2 32,691,895 (GRCm39) missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32,713,550 (GRCm39) missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32,691,882 (GRCm39) missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32,692,795 (GRCm39) missense probably damaging 1.00
R0285:Stxbp1 UTSW 2 32,713,554 (GRCm39) missense probably benign 0.00
R0335:Stxbp1 UTSW 2 32,692,917 (GRCm39) splice site probably benign
R0565:Stxbp1 UTSW 2 32,709,860 (GRCm39) missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32,692,795 (GRCm39) missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32,690,707 (GRCm39) splice site probably benign
R1022:Stxbp1 UTSW 2 32,704,979 (GRCm39) splice site probably null
R1024:Stxbp1 UTSW 2 32,704,979 (GRCm39) splice site probably null
R1295:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32,690,629 (GRCm39) missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32,696,731 (GRCm39) critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32,688,201 (GRCm39) missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32,684,686 (GRCm39) missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32,686,030 (GRCm39) missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32,684,621 (GRCm39) missense probably damaging 0.98
R6504:Stxbp1 UTSW 2 32,691,895 (GRCm39) missense possibly damaging 0.95
R6770:Stxbp1 UTSW 2 32,709,901 (GRCm39) missense probably benign 0.01
R6954:Stxbp1 UTSW 2 32,691,905 (GRCm39) missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32,705,026 (GRCm39) missense probably damaging 1.00
R7382:Stxbp1 UTSW 2 32,688,180 (GRCm39) missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32,708,517 (GRCm39) missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32,691,832 (GRCm39) missense probably benign 0.00
R8364:Stxbp1 UTSW 2 32,696,774 (GRCm39) missense possibly damaging 0.72
R8462:Stxbp1 UTSW 2 32,707,293 (GRCm39) splice site probably null
R9143:Stxbp1 UTSW 2 32,688,157 (GRCm39) missense probably damaging 0.99
R9246:Stxbp1 UTSW 2 32,679,586 (GRCm39) missense possibly damaging 0.85
R9267:Stxbp1 UTSW 2 32,708,517 (GRCm39) missense probably damaging 1.00
R9501:Stxbp1 UTSW 2 32,692,825 (GRCm39) missense probably benign 0.00
R9600:Stxbp1 UTSW 2 32,701,120 (GRCm39) missense possibly damaging 0.80
RF010:Stxbp1 UTSW 2 32,711,927 (GRCm39) missense probably benign 0.06
X0060:Stxbp1 UTSW 2 32,692,780 (GRCm39) missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32,699,140 (GRCm39) missense probably damaging 0.99
Z1177:Stxbp1 UTSW 2 32,692,766 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGCATCTGCACTGTTCG -3'
(R):5'- TTTGGAAGGACTCTCAGGGC -3'

Sequencing Primer
(F):5'- ATCTGCACTGTTCGCTCTCTG -3'
(R):5'- AGGATTCTATGTCAGCCCGATGC -3'
Posted On 2014-10-01