Incidental Mutation 'R2153:Rif1'
ID 234473
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms D2Ertd145e, 6530403D07Rik, 5730435J01Rik
MMRRC Submission 040156-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2153 (G1)
Quality Score 217
Status Not validated
Chromosome 2
Chromosomal Location 51962844-52012395 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCCACCA to GCCA at 52000336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069794
AA Change: 1264
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: 1264

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112693
AA Change: P1264
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: P1264

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125322
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,208,959 (GRCm39) E363G probably benign Het
Abcg2 T A 6: 58,661,307 (GRCm39) probably null Het
Adgrg7 T G 16: 56,572,791 (GRCm39) I342L possibly damaging Het
Akap6 A C 12: 53,188,187 (GRCm39) D1867A probably benign Het
Ankrd17 A T 5: 90,381,918 (GRCm39) V2416D probably damaging Het
Apaf1 A G 10: 90,883,952 (GRCm39) V670A probably damaging Het
Art5 A G 7: 101,747,407 (GRCm39) L124P possibly damaging Het
Atad5 T A 11: 79,997,203 (GRCm39) D842E probably benign Het
Brd10 T C 19: 29,694,229 (GRCm39) M1755V probably benign Het
Capns1 A G 7: 29,891,765 (GRCm39) L124P probably damaging Het
Carmil1 A G 13: 24,325,656 (GRCm39) S225P probably damaging Het
Cars2 C T 8: 11,580,299 (GRCm39) A247T possibly damaging Het
Cd46 A G 1: 194,744,721 (GRCm39) I339T probably benign Het
Ceacam14 C A 7: 17,548,153 (GRCm39) T81N probably benign Het
Ceacam16 G A 7: 19,595,066 (GRCm39) P4L probably benign Het
Chek1 C A 9: 36,635,279 (GRCm39) V35F probably damaging Het
Cntnap5c A T 17: 58,362,666 (GRCm39) I340L possibly damaging Het
Col2a1 C A 15: 97,885,461 (GRCm39) A461S unknown Het
Comtd1 T C 14: 21,898,340 (GRCm39) E27G possibly damaging Het
Cyp2a12 A G 7: 26,732,042 (GRCm39) N261S probably benign Het
Dclk1 A G 3: 55,154,633 (GRCm39) Y21C probably damaging Het
Dis3l T A 9: 64,214,545 (GRCm39) N981I probably benign Het
Dlg5 A T 14: 24,187,225 (GRCm39) I1819N probably damaging Het
Elp1 T A 4: 56,779,636 (GRCm39) probably null Het
Enpep T C 3: 129,074,231 (GRCm39) N772S probably damaging Het
Erich1 T C 8: 14,128,773 (GRCm39) T56A probably benign Het
Ermp1 T C 19: 29,614,798 (GRCm39) probably null Het
Etl4 A G 2: 20,803,545 (GRCm39) E807G probably benign Het
Fat4 A T 3: 39,037,544 (GRCm39) Y3732F probably damaging Het
Fbxw18 T G 9: 109,522,438 (GRCm39) T144P probably damaging Het
Flywch1 A T 17: 23,974,624 (GRCm39) I672K probably benign Het
Foxk2 C A 11: 121,151,213 (GRCm39) A86E probably benign Het
Garem2 T C 5: 30,313,297 (GRCm39) S54P probably damaging Het
Gda A G 19: 21,374,869 (GRCm39) probably null Het
Gna15 T C 10: 81,338,738 (GRCm39) Y367C probably damaging Het
Golga3 A G 5: 110,335,856 (GRCm39) probably null Het
Greb1 T C 12: 16,749,533 (GRCm39) S1098G probably damaging Het
Hook3 C A 8: 26,560,225 (GRCm39) L333F probably damaging Het
Il6 C T 5: 30,218,502 (GRCm39) Q33* probably null Het
Iqgap1 T C 7: 80,401,701 (GRCm39) E468G probably benign Het
Iqgap1 A G 7: 80,409,651 (GRCm39) I228T possibly damaging Het
Kat6b A T 14: 21,718,735 (GRCm39) H1138L probably benign Het
Kcnab1 A T 3: 65,278,861 (GRCm39) I371F probably damaging Het
Kcnj10 A T 1: 172,197,455 (GRCm39) Y323F possibly damaging Het
Klk1b5 T C 7: 43,869,322 (GRCm39) probably null Het
Lmo7 A G 14: 102,157,951 (GRCm39) probably benign Het
Loxhd1 A T 18: 77,443,862 (GRCm39) T277S possibly damaging Het
Lrp5 A T 19: 3,664,339 (GRCm39) M796K probably benign Het
Med15 A T 16: 17,503,315 (GRCm39) probably null Het
Mfn1 T A 3: 32,596,975 (GRCm39) H144Q probably damaging Het
Mmp25 T A 17: 23,850,048 (GRCm39) Y504F probably damaging Het
Nmi T C 2: 51,842,555 (GRCm39) E179G probably damaging Het
Nrxn2 T C 19: 6,554,944 (GRCm39) I1141T probably damaging Het
Olah T C 2: 3,366,306 (GRCm39) S9G probably benign Het
Or1m1 T C 9: 18,666,391 (GRCm39) D180G probably damaging Het
Or4c106 C A 2: 88,683,128 (GRCm39) P278H probably damaging Het
Or5b120 T G 19: 13,479,852 (GRCm39) I48M probably damaging Het
Or8b49 G T 9: 38,505,707 (GRCm39) L63F probably damaging Het
Or8k22 A C 2: 86,162,872 (GRCm39) F276C probably damaging Het
Otog T A 7: 45,952,328 (GRCm39) C2591S probably damaging Het
Pdgfrb G T 18: 61,205,828 (GRCm39) V605F probably damaging Het
Pik3cb T A 9: 98,983,297 (GRCm39) K104* probably null Het
Plb1 T A 5: 32,471,433 (GRCm39) I580N probably damaging Het
Plekha2 T C 8: 25,578,413 (GRCm39) Y29C probably damaging Het
Plekha7 T A 7: 115,775,002 (GRCm39) Y213F probably damaging Het
Plin5 T C 17: 56,423,836 (GRCm39) D33G probably benign Het
Pnpla2 C A 7: 141,039,132 (GRCm39) Q371K probably damaging Het
Ppm1n A G 7: 19,012,110 (GRCm39) Y348H probably damaging Het
Ppp2r1b T A 9: 50,777,854 (GRCm39) D266E probably damaging Het
Prss23 A G 7: 89,159,119 (GRCm39) S317P probably damaging Het
Prss33 C T 17: 24,053,817 (GRCm39) V87M probably damaging Het
Ptpn12 C A 5: 21,207,466 (GRCm39) Q297H probably damaging Het
Pum1 G T 4: 130,478,802 (GRCm39) A571S probably damaging Het
Rexo1 G T 10: 80,379,943 (GRCm39) C13* probably null Het
Rhpn1 A T 15: 75,576,243 (GRCm39) M1L probably null Het
Ripk2 A G 4: 16,132,775 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,530,920 (GRCm39) Y937C probably damaging Het
Rrbp1 A G 2: 143,796,118 (GRCm39) L1200P possibly damaging Het
Ryr2 A G 13: 11,592,759 (GRCm39) I4665T possibly damaging Het
Sbno1 C A 5: 124,516,606 (GRCm39) V1256F probably benign Het
Senp5 T C 16: 31,787,692 (GRCm39) I644V probably damaging Het
Serpinb9e T A 13: 33,436,961 (GRCm39) F94I probably damaging Het
Sidt2 T C 9: 45,856,638 (GRCm39) D477G probably damaging Het
Slc30a5 A T 13: 100,940,457 (GRCm39) H619Q probably damaging Het
Slmap A G 14: 26,139,402 (GRCm39) Y771H probably damaging Het
Sned1 T A 1: 93,202,379 (GRCm39) D674E probably benign Het
Sorl1 T C 9: 41,895,788 (GRCm39) H1789R probably benign Het
Sp2 T C 11: 96,852,834 (GRCm39) D30G possibly damaging Het
Stk33 T A 7: 108,940,527 (GRCm39) N61I probably benign Het
Stxbp1 T A 2: 32,692,868 (GRCm39) I383F probably damaging Het
Tbcd A G 11: 121,494,457 (GRCm39) Q1006R possibly damaging Het
Tln2 T C 9: 67,209,842 (GRCm39) T432A probably damaging Het
Tnfrsf21 A G 17: 43,398,763 (GRCm39) D623G probably damaging Het
Trib2 A G 12: 15,843,830 (GRCm39) F271L probably damaging Het
Ttn A G 2: 76,810,477 (GRCm39) V17A probably benign Het
Ubqlnl A T 7: 103,797,890 (GRCm39) C536S probably benign Het
Vmn1r230 T A 17: 21,067,063 (GRCm39) M84K probably damaging Het
Vmn2r97 A T 17: 19,167,584 (GRCm39) R613* probably null Het
Yeats2 T A 16: 19,972,916 (GRCm39) D23E probably damaging Het
Zan T A 5: 137,434,662 (GRCm39) I2214F unknown Het
Zbtb40 T C 4: 136,718,946 (GRCm39) D917G probably damaging Het
Zcchc2 C A 1: 105,949,453 (GRCm39) probably null Het
Zdhhc23 G T 16: 43,794,282 (GRCm39) Q131K probably benign Het
Zfp345 T C 2: 150,314,578 (GRCm39) T320A probably benign Het
Zfp532 A G 18: 65,757,998 (GRCm39) T644A possibly damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52,011,019 (GRCm39) missense probably damaging 0.96
IGL00711:Rif1 APN 2 52,001,082 (GRCm39) missense probably benign 0.00
IGL00721:Rif1 APN 2 52,009,129 (GRCm39) missense probably damaging 1.00
IGL01085:Rif1 APN 2 51,975,152 (GRCm39) missense possibly damaging 0.71
IGL01093:Rif1 APN 2 51,985,960 (GRCm39) missense probably damaging 1.00
IGL01107:Rif1 APN 2 52,001,315 (GRCm39) missense probably benign 0.00
IGL01138:Rif1 APN 2 52,001,534 (GRCm39) missense probably damaging 1.00
IGL01844:Rif1 APN 2 52,002,555 (GRCm39) missense probably benign 0.07
IGL02441:Rif1 APN 2 51,995,527 (GRCm39) missense probably benign 0.00
IGL02448:Rif1 APN 2 52,006,708 (GRCm39) missense probably damaging 0.99
IGL02563:Rif1 APN 2 51,967,077 (GRCm39) missense probably damaging 1.00
IGL02704:Rif1 APN 2 51,983,588 (GRCm39) missense probably damaging 1.00
IGL02946:Rif1 APN 2 52,000,137 (GRCm39) nonsense probably null
IGL03060:Rif1 APN 2 52,002,149 (GRCm39) missense probably damaging 0.97
IGL03206:Rif1 APN 2 51,993,634 (GRCm39) missense probably damaging 1.00
IGL03263:Rif1 APN 2 51,980,273 (GRCm39) missense probably damaging 0.99
IGL03267:Rif1 APN 2 51,967,000 (GRCm39) missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52,002,611 (GRCm39) missense probably benign 0.32
hifi UTSW 2 52,000,336 (GRCm39) unclassified probably benign
nietzsche UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52,001,970 (GRCm39) missense
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0104:Rif1 UTSW 2 52,000,104 (GRCm39) missense possibly damaging 0.77
R0268:Rif1 UTSW 2 51,980,298 (GRCm39) critical splice donor site probably null
R0276:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0278:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0288:Rif1 UTSW 2 52,000,025 (GRCm39) missense probably damaging 1.00
R0314:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0345:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0346:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0383:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R0384:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0387:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0388:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0456:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0477:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0505:Rif1 UTSW 2 52,000,749 (GRCm39) missense probably damaging 0.99
R0510:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0511:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0633:Rif1 UTSW 2 52,002,575 (GRCm39) missense probably benign 0.00
R0637:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0638:Rif1 UTSW 2 52,001,600 (GRCm39) missense probably benign 0.12
R0666:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0675:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0707:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0726:Rif1 UTSW 2 52,000,365 (GRCm39) missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0744:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0938:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0939:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0940:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0941:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0942:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0943:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1006:Rif1 UTSW 2 51,975,041 (GRCm39) missense probably damaging 0.99
R1052:Rif1 UTSW 2 52,001,574 (GRCm39) missense probably benign 0.01
R1061:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1175:Rif1 UTSW 2 51,997,640 (GRCm39) unclassified probably benign
R1183:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1184:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1271:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1332:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1336:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1351:Rif1 UTSW 2 52,001,567 (GRCm39) missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1527:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1560:Rif1 UTSW 2 52,001,143 (GRCm39) missense probably damaging 1.00
R1563:Rif1 UTSW 2 51,963,235 (GRCm39) missense probably damaging 0.99
R1571:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1625:Rif1 UTSW 2 51,993,652 (GRCm39) missense probably benign 0.25
R1679:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1689:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1731:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1744:Rif1 UTSW 2 52,002,404 (GRCm39) missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1748:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1831:Rif1 UTSW 2 51,968,507 (GRCm39) nonsense probably null
R1902:Rif1 UTSW 2 52,006,685 (GRCm39) missense possibly damaging 0.93
R1964:Rif1 UTSW 2 51,988,421 (GRCm39) missense probably benign 0.01
R1978:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2000:Rif1 UTSW 2 51,971,310 (GRCm39) missense probably damaging 0.99
R2030:Rif1 UTSW 2 51,982,358 (GRCm39) missense probably damaging 1.00
R2056:Rif1 UTSW 2 51,983,588 (GRCm39) missense probably damaging 1.00
R2106:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2109:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2125:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2126:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2145:Rif1 UTSW 2 52,001,412 (GRCm39) missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2213:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2327:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2513:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2516:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2520:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2905:Rif1 UTSW 2 51,988,516 (GRCm39) missense probably damaging 0.99
R3005:Rif1 UTSW 2 51,972,776 (GRCm39) missense probably damaging 1.00
R3155:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3156:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3429:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3707:Rif1 UTSW 2 51,983,592 (GRCm39) missense probably damaging 1.00
R3907:Rif1 UTSW 2 52,002,557 (GRCm39) missense probably benign 0.03
R3978:Rif1 UTSW 2 52,006,759 (GRCm39) critical splice donor site probably null
R4023:Rif1 UTSW 2 52,011,099 (GRCm39) missense probably benign 0.01
R4052:Rif1 UTSW 2 51,988,483 (GRCm39) nonsense probably null
R4668:Rif1 UTSW 2 52,001,964 (GRCm39) missense probably benign 0.01
R4674:Rif1 UTSW 2 51,996,954 (GRCm39) missense probably null 1.00
R4715:Rif1 UTSW 2 51,963,151 (GRCm39) utr 5 prime probably benign
R4766:Rif1 UTSW 2 51,988,946 (GRCm39) missense probably damaging 1.00
R4783:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4785:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4869:Rif1 UTSW 2 51,983,623 (GRCm39) intron probably benign
R4911:Rif1 UTSW 2 52,000,530 (GRCm39) missense probably damaging 0.98
R4951:Rif1 UTSW 2 51,974,998 (GRCm39) splice site probably null
R5044:Rif1 UTSW 2 51,999,940 (GRCm39) missense probably damaging 0.99
R5088:Rif1 UTSW 2 51,982,307 (GRCm39) missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52,010,321 (GRCm39) missense probably damaging 1.00
R5187:Rif1 UTSW 2 51,971,301 (GRCm39) missense probably damaging 1.00
R5222:Rif1 UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
R5243:Rif1 UTSW 2 52,001,836 (GRCm39) missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52,010,983 (GRCm39) intron probably benign
R5476:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
R5496:Rif1 UTSW 2 51,988,928 (GRCm39) missense probably damaging 1.00
R5641:Rif1 UTSW 2 52,011,170 (GRCm39) missense possibly damaging 0.80
R5883:Rif1 UTSW 2 51,995,651 (GRCm39) critical splice donor site probably null
R5987:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5990:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5992:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6019:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6020:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6255:Rif1 UTSW 2 51,975,065 (GRCm39) missense probably damaging 1.00
R6342:Rif1 UTSW 2 52,009,168 (GRCm39) missense probably damaging 0.97
R6364:Rif1 UTSW 2 51,997,681 (GRCm39) missense probably damaging 0.97
R6747:Rif1 UTSW 2 51,968,275 (GRCm39) splice site probably null
R6928:Rif1 UTSW 2 51,985,973 (GRCm39) missense probably damaging 1.00
R6954:Rif1 UTSW 2 52,002,703 (GRCm39) missense probably benign 0.00
R7003:Rif1 UTSW 2 51,967,001 (GRCm39) missense probably benign 0.06
R7310:Rif1 UTSW 2 51,995,631 (GRCm39) missense probably benign 0.12
R7549:Rif1 UTSW 2 51,968,519 (GRCm39) missense possibly damaging 0.52
R7603:Rif1 UTSW 2 51,966,187 (GRCm39) missense probably damaging 1.00
R7673:Rif1 UTSW 2 51,978,666 (GRCm39) missense probably damaging 1.00
R7741:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R7777:Rif1 UTSW 2 52,006,368 (GRCm39) missense probably benign 0.00
R7910:Rif1 UTSW 2 51,968,399 (GRCm39) nonsense probably null
R7962:Rif1 UTSW 2 51,964,288 (GRCm39) missense probably damaging 1.00
R8264:Rif1 UTSW 2 51,980,290 (GRCm39) missense noncoding transcript
R8390:Rif1 UTSW 2 52,000,935 (GRCm39) missense probably damaging 1.00
R8479:Rif1 UTSW 2 52,002,563 (GRCm39) missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52,001,011 (GRCm39) missense probably damaging 0.96
R8762:Rif1 UTSW 2 52,001,742 (GRCm39) missense
R8785:Rif1 UTSW 2 52,000,493 (GRCm39) missense probably benign 0.06
R8890:Rif1 UTSW 2 51,988,875 (GRCm39) missense probably damaging 0.99
R9081:Rif1 UTSW 2 52,000,989 (GRCm39) missense probably damaging 0.99
R9225:Rif1 UTSW 2 52,001,862 (GRCm39) missense probably benign 0.22
R9284:Rif1 UTSW 2 51,998,564 (GRCm39) missense probably benign 0.00
R9300:Rif1 UTSW 2 52,001,151 (GRCm39) missense probably damaging 1.00
R9366:Rif1 UTSW 2 52,010,356 (GRCm39) missense
R9477:Rif1 UTSW 2 52,001,342 (GRCm39) missense probably benign 0.02
R9522:Rif1 UTSW 2 51,971,311 (GRCm39) missense probably damaging 1.00
R9573:Rif1 UTSW 2 52,000,466 (GRCm39) missense probably benign 0.29
R9630:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
X0064:Rif1 UTSW 2 51,984,645 (GRCm39) missense probably damaging 0.96
X0064:Rif1 UTSW 2 51,964,327 (GRCm39) missense probably benign 0.00
Z1177:Rif1 UTSW 2 51,978,660 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGTCAGCAGTAGTTCAG -3'
(R):5'- ACACATGTTCTGTTGGGCTG -3'

Sequencing Primer
(F):5'- GCAGTAGTTCAGTTTCTAATGCCAC -3'
(R):5'- AGCAGATCAGGAGAGTTATTTTCG -3'
Posted On 2014-10-01