Incidental Mutation 'R0196:R3hdm2'
ID23449
Institutional Source Beutler Lab
Gene Symbol R3hdm2
Ensembl Gene ENSMUSG00000025404
Gene NameR3H domain containing 2
Synonyms
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R0196 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127380327-127499384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127484521 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 523 (Y523H)
Ref Sequence ENSEMBL: ENSMUSP00000131007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000166820] [ENSMUST00000168079] [ENSMUST00000169888] [ENSMUST00000170336]
Predicted Effect probably damaging
Transcript: ENSMUST00000064793
AA Change: Y544H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404
AA Change: Y544H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077046
AA Change: Y589H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404
AA Change: Y589H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105249
AA Change: Y537H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404
AA Change: Y537H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105250
AA Change: Y571H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404
AA Change: Y571H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105251
AA Change: Y571H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404
AA Change: Y571H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164469
Predicted Effect probably damaging
Transcript: ENSMUST00000164831
AA Change: Y523H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404
AA Change: Y523H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166820
AA Change: Y589H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404
AA Change: Y589H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168079
SMART Domains Protein: ENSMUSP00000130506
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168268
Predicted Effect probably damaging
Transcript: ENSMUST00000169888
AA Change: Y288H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404
AA Change: Y288H

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170336
AA Change: Y557H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404
AA Change: Y557H

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171823
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in R3hdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:R3hdm2 APN 10 127458850 missense probably damaging 1.00
IGL02114:R3hdm2 APN 10 127484109 missense probably damaging 0.99
IGL02116:R3hdm2 APN 10 127498552 missense probably damaging 1.00
IGL02549:R3hdm2 APN 10 127484225 splice site probably benign
IGL02647:R3hdm2 APN 10 127459484 missense probably damaging 1.00
IGL02696:R3hdm2 APN 10 127465019 splice site probably null
IGL02732:R3hdm2 APN 10 127484060 missense probably benign 0.43
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0132:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0157:R3hdm2 UTSW 10 127471989 missense probably damaging 0.99
R0179:R3hdm2 UTSW 10 127495106 missense probably damaging 1.00
R0401:R3hdm2 UTSW 10 127458173 missense possibly damaging 0.90
R0505:R3hdm2 UTSW 10 127457700 missense probably damaging 1.00
R0606:R3hdm2 UTSW 10 127444444 missense probably damaging 1.00
R1188:R3hdm2 UTSW 10 127452755 missense probably benign 0.02
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1503:R3hdm2 UTSW 10 127471826 nonsense probably null
R1584:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1652:R3hdm2 UTSW 10 127495091 missense probably benign 0.00
R1901:R3hdm2 UTSW 10 127498468 missense possibly damaging 0.91
R3735:R3hdm2 UTSW 10 127465010 missense probably benign
R5261:R3hdm2 UTSW 10 127498416 missense probably damaging 1.00
R5329:R3hdm2 UTSW 10 127458893 missense probably damaging 1.00
R5379:R3hdm2 UTSW 10 127471902 missense probably damaging 1.00
R5380:R3hdm2 UTSW 10 127485447 missense probably damaging 1.00
R5387:R3hdm2 UTSW 10 127485434 missense probably damaging 1.00
R5558:R3hdm2 UTSW 10 127444402 missense probably damaging 1.00
R5773:R3hdm2 UTSW 10 127444303 utr 5 prime probably benign
R5936:R3hdm2 UTSW 10 127471812 missense probably damaging 1.00
R6024:R3hdm2 UTSW 10 127459480 missense probably damaging 1.00
R6160:R3hdm2 UTSW 10 127484507 missense probably damaging 1.00
R6191:R3hdm2 UTSW 10 127484515 missense probably damaging 1.00
R7058:R3hdm2 UTSW 10 127484513 missense probably damaging 1.00
R7224:R3hdm2 UTSW 10 127458153 missense probably damaging 1.00
R7253:R3hdm2 UTSW 10 127481775 missense probably damaging 1.00
R7305:R3hdm2 UTSW 10 127476678 missense probably benign 0.08
R7349:R3hdm2 UTSW 10 127492646 missense probably benign
R7431:R3hdm2 UTSW 10 127458147 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCATCAGTTGTCCCACATCAGCC -3'
(R):5'- TTAACTCCGCAGATGGGAAGCCTC -3'

Sequencing Primer
(F):5'- CCTTTCTGCACAGCAGTGG -3'
(R):5'- AGATGGGAAGCCTCTCTCC -3'
Posted On2013-04-16