Mutagenetix > Incidental Mutation

Incidental Mutation 'R2153:Golga3'

234494

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

MMRRC Submission

040156-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2153 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 110187990 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512] [ENSMUST00000139611]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000031477

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112512

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125380

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136900

Predicted Effect

probably benign
Transcript: ENSMUST00000139611

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,455,115	E363G	probably benign	Het
9930021J03Rik	T	C	19: 29,716,829	M1755V	probably benign	Het
Abcg2	T	A	6: 58,684,322		probably null	Het
Adgrg7	T	G	16: 56,752,428	I342L	possibly damaging	Het
Akap6	A	C	12: 53,141,404	D1867A	probably benign	Het
Ankrd17	A	T	5: 90,234,059	V2416D	probably damaging	Het
Apaf1	A	G	10: 91,048,090	V670A	probably damaging	Het
Art5	A	G	7: 102,098,200	L124P	possibly damaging	Het
Atad5	T	A	11: 80,106,377	D842E	probably benign	Het
Capns1	A	G	7: 30,192,340	L124P	probably damaging	Het
Carmil1	A	G	13: 24,141,673	S225P	probably damaging	Het
Cars2	C	T	8: 11,530,299	A247T	possibly damaging	Het
Cd46	A	G	1: 195,062,413	I339T	probably benign	Het
Ceacam14	C	A	7: 17,814,228	T81N	probably benign	Het
Ceacam16	G	A	7: 19,861,141	P4L	probably benign	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cntnap5c	A	T	17: 58,055,671	I340L	possibly damaging	Het
Col2a1	C	A	15: 97,987,580	A461S	unknown	Het
Comtd1	T	C	14: 21,848,272	E27G	possibly damaging	Het
Cyp2a12	A	G	7: 27,032,617	N261S	probably benign	Het
Dclk1	A	G	3: 55,247,212	Y21C	probably damaging	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dlg5	A	T	14: 24,137,157	I1819N	probably damaging	Het
Enpep	T	C	3: 129,280,582	N772S	probably damaging	Het
Erich1	T	C	8: 14,078,773	T56A	probably benign	Het
Ermp1	T	C	19: 29,637,398		probably null	Het
Etl4	A	G	2: 20,798,734	E807G	probably benign	Het
Fat4	A	T	3: 38,983,395	Y3732F	probably damaging	Het
Fbxw18	T	G	9: 109,693,370	T144P	probably damaging	Het
Flywch1	A	T	17: 23,755,650	I672K	probably benign	Het
Foxk2	C	A	11: 121,260,387	A86E	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gda	A	G	19: 21,397,505		probably null	Het
Gna15	T	C	10: 81,502,904	Y367C	probably damaging	Het
Greb1	T	C	12: 16,699,532	S1098G	probably damaging	Het
Hook3	C	A	8: 26,070,197	L333F	probably damaging	Het
Ikbkap	T	A	4: 56,779,636		probably null	Het
Il6	C	T	5: 30,013,504	Q33*	probably null	Het
Iqgap1	T	C	7: 80,751,953	E468G	probably benign	Het
Iqgap1	A	G	7: 80,759,903	I228T	possibly damaging	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kcnab1	A	T	3: 65,371,440	I371F	probably damaging	Het
Kcnj10	A	T	1: 172,369,888	Y323F	possibly damaging	Het
Klk1b5	T	C	7: 44,219,898		probably null	Het
Lmo7	A	G	14: 101,920,515		probably benign	Het
Loxhd1	A	T	18: 77,356,166	T277S	possibly damaging	Het
Lrp5	A	T	19: 3,614,339	M796K	probably benign	Het
Med15	A	T	16: 17,685,451		probably null	Het
Mfn1	T	A	3: 32,542,826	H144Q	probably damaging	Het
Mmp25	T	A	17: 23,631,074	Y504F	probably damaging	Het
Nmi	T	C	2: 51,952,543	E179G	probably damaging	Het
Nrxn2	T	C	19: 6,504,914	I1141T	probably damaging	Het
Olah	T	C	2: 3,365,269	S9G	probably benign	Het
Olfr1054	A	C	2: 86,332,528	F276C	probably damaging	Het
Olfr1204	C	A	2: 88,852,784	P278H	probably damaging	Het
Olfr1477	T	G	19: 13,502,488	I48M	probably damaging	Het
Olfr24	T	C	9: 18,755,095	D180G	probably damaging	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Otog	T	A	7: 46,302,904	C2591S	probably damaging	Het
Pdgfrb	G	T	18: 61,072,756	V605F	probably damaging	Het
Pik3cb	T	A	9: 99,101,244	K104*	probably null	Het
Plb1	T	A	5: 32,314,089	I580N	probably damaging	Het
Plekha2	T	C	8: 25,088,397	Y29C	probably damaging	Het
Plekha7	T	A	7: 116,175,767	Y213F	probably damaging	Het
Plin5	T	C	17: 56,116,836	D33G	probably benign	Het
Pnpla2	C	A	7: 141,459,219	Q371K	probably damaging	Het
Ppm1n	A	G	7: 19,278,185	Y348H	probably damaging	Het
Ppp2r1b	T	A	9: 50,866,554	D266E	probably damaging	Het
Prss23	A	G	7: 89,509,911	S317P	probably damaging	Het
Prss33	C	T	17: 23,834,843	V87M	probably damaging	Het
Ptpn12	C	A	5: 21,002,468	Q297H	probably damaging	Het
Pum1	G	T	4: 130,751,491	A571S	probably damaging	Het
Rexo1	G	T	10: 80,544,109	C13*	probably null	Het
Rhpn1	A	T	15: 75,704,394	M1L	probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Ripk2	A	G	4: 16,132,775		probably null	Het
Rps6kc1	T	C	1: 190,798,723	Y937C	probably damaging	Het
Rrbp1	A	G	2: 143,954,198	L1200P	possibly damaging	Het
Ryr2	A	G	13: 11,577,873	I4665T	possibly damaging	Het
Sbno1	C	A	5: 124,378,543	V1256F	probably benign	Het
Senp5	T	C	16: 31,968,874	I644V	probably damaging	Het
Serpinb9e	T	A	13: 33,252,978	F94I	probably damaging	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc30a5	A	T	13: 100,803,949	H619Q	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Sned1	T	A	1: 93,274,657	D674E	probably benign	Het
Sorl1	T	C	9: 41,984,492	H1789R	probably benign	Het
Sp2	T	C	11: 96,962,008	D30G	possibly damaging	Het
Stk33	T	A	7: 109,341,320	N61I	probably benign	Het
Stxbp1	T	A	2: 32,802,856	I383F	probably damaging	Het
Tbcd	A	G	11: 121,603,631	Q1006R	possibly damaging	Het
Tln2	T	C	9: 67,302,560	T432A	probably damaging	Het
Tnfrsf21	A	G	17: 43,087,872	D623G	probably damaging	Het
Trib2	A	G	12: 15,793,829	F271L	probably damaging	Het
Ttn	A	G	2: 76,980,133	V17A	probably benign	Het
Ubqlnl	A	T	7: 104,148,683	C536S	probably benign	Het
Vmn1r230	T	A	17: 20,846,801	M84K	probably damaging	Het
Vmn2r97	A	T	17: 18,947,322	R613*	probably null	Het
Yeats2	T	A	16: 20,154,166	D23E	probably damaging	Het
Zan	T	A	5: 137,436,400	I2214F	unknown	Het
Zbtb40	T	C	4: 136,991,635	D917G	probably damaging	Het
Zcchc2	C	A	1: 106,021,723		probably null	Het
Zdhhc23	G	T	16: 43,973,919	Q131K	probably benign	Het
Zfp345	T	C	2: 150,472,658	T320A	probably benign	Het
Zfp532	A	G	18: 65,624,927	T644A	possibly damaging	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3276:Golga3	UTSW	5	110201998	splice site	probably benign
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5399:Golga3	UTSW	5	110205024	missense	probably damaging	0.96
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6087:Golga3	UTSW	5	110204946	missense	probably damaging	0.99
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7057:Golga3	UTSW	5	110188663	missense	probably damaging	1.00
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8558:Golga3	UTSW	5	110208555	missense	possibly damaging	0.83
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9045:Golga3	UTSW	5	110193097	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9112:Golga3	UTSW	5	110185891	missense	probably benign	0.08
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11
R9755:Golga3	UTSW	5	110192981	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- CATGCCAGGAACAGCTTACATG -3'
(R):5'- CTCCTACAGAAGAGCATGCTC -3'

Sequencing Primer
(F):5'- AACAGCTTACATGGTTGATGGCC -3'
(R):5'- TCTTAAGAGATAGGGCTACACTGC -3'

Posted On

2014-10-01