Incidental Mutation 'R0196:Egfr'
ID23450
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R0196 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16911746 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1175 (D1175G)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329]
Predicted Effect probably benign
Transcript: ENSMUST00000020329
AA Change: D1175G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: D1175G

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138518
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7195:Egfr UTSW 11 16868162 missense probably damaging 1.00
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7612:Egfr UTSW 11 16859025 missense possibly damaging 0.74
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTATCACAATCAGCCCCTGCATC -3'
(R):5'- ATTTGACACAGCGTGGGCATGG -3'

Sequencing Primer
(F):5'- TCCAGCTCCTGGAAGAGAC -3'
(R):5'- CTACCAGAAGTGGAGGTGCTG -3'
Posted On2013-04-16