Mutagenetix > Incidental Mutations

Incidental Mutation 'R0196:Egfr'

23450

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

038455-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R0196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16911746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1175 (D1175G)

Ref Sequence

ENSEMBL: ENSMUSP00000020329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329]

AlphaFold

Q01279

Predicted Effect

probably benign
Transcript: ENSMUST00000020329
AA Change: D1175G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: D1175G

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138518

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
R8708:Egfr	UTSW	11	16867300	critical splice donor site	probably benign
R8804:Egfr	UTSW	11	16869339	missense	probably benign	0.09
R8853:Egfr	UTSW	11	16908885	missense	possibly damaging	0.93
R8906:Egfr	UTSW	11	16911635	missense	probably damaging	1.00
R9177:Egfr	UTSW	11	16905410	missense	probably damaging	1.00
R9268:Egfr	UTSW	11	16905410	missense	probably damaging	1.00
R9335:Egfr	UTSW	11	16870991	missense	probably damaging	1.00
R9417:Egfr	UTSW	11	16875067	nonsense	probably null
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTATCACAATCAGCCCCTGCATC -3'
(R):5'- ATTTGACACAGCGTGGGCATGG -3'

Sequencing Primer
(F):5'- TCCAGCTCCTGGAAGAGAC -3'
(R):5'- CTACCAGAAGTGGAGGTGCTG -3'

Posted On

2013-04-16