Incidental Mutation 'R2153:Capns1'
ID234503
Institutional Source Beutler Lab
Gene Symbol Capns1
Ensembl Gene ENSMUSG00000001794
Gene Namecalpain, small subunit 1
SynonymsD7Ertd146e, Capa-4, Capn4, Capa4
MMRRC Submission 040156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2153 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30186936-30198811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30192340 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 124 (L124P)
Ref Sequence ENSEMBL: ENSMUSP00000117951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001845] [ENSMUST00000108196] [ENSMUST00000126116]
Predicted Effect probably damaging
Transcript: ENSMUST00000001845
AA Change: L124P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001845
Gene: ENSMUSG00000001794
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
EFh 238 265 6.09e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108196
AA Change: L56P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103831
Gene: ENSMUSG00000001794
AA Change: L56P

DomainStartEndE-ValueType
EFh 75 103 3.93e0 SMART
EFh 105 133 1.42e1 SMART
EFh 170 197 6.09e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126116
AA Change: L124P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117951
Gene: ENSMUSG00000001794
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208688
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E11.5. Mutant embryos exhibit cardiac developmental defects, reduced yolk sac vasculature, hemorrhaging in the area between the embryo and amnion, and accumulation of nucleated erythroid cells in the heart chambers, blood vessels, and developing liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
9930021J03Rik T C 19: 29,716,829 M1755V probably benign Het
Abcg2 T A 6: 58,684,322 probably null Het
Adgrg7 T G 16: 56,752,428 I342L possibly damaging Het
Akap6 A C 12: 53,141,404 D1867A probably benign Het
Ankrd17 A T 5: 90,234,059 V2416D probably damaging Het
Apaf1 A G 10: 91,048,090 V670A probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Atad5 T A 11: 80,106,377 D842E probably benign Het
Carmil1 A G 13: 24,141,673 S225P probably damaging Het
Cars2 C T 8: 11,530,299 A247T possibly damaging Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Ceacam14 C A 7: 17,814,228 T81N probably benign Het
Ceacam16 G A 7: 19,861,141 P4L probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntnap5c A T 17: 58,055,671 I340L possibly damaging Het
Col2a1 C A 15: 97,987,580 A461S unknown Het
Comtd1 T C 14: 21,848,272 E27G possibly damaging Het
Cyp2a12 A G 7: 27,032,617 N261S probably benign Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dlg5 A T 14: 24,137,157 I1819N probably damaging Het
Enpep T C 3: 129,280,582 N772S probably damaging Het
Erich1 T C 8: 14,078,773 T56A probably benign Het
Ermp1 T C 19: 29,637,398 probably null Het
Etl4 A G 2: 20,798,734 E807G probably benign Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fbxw18 T G 9: 109,693,370 T144P probably damaging Het
Flywch1 A T 17: 23,755,650 I672K probably benign Het
Foxk2 C A 11: 121,260,387 A86E probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gda A G 19: 21,397,505 probably null Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Golga3 A G 5: 110,187,990 probably null Het
Greb1 T C 12: 16,699,532 S1098G probably damaging Het
Hook3 C A 8: 26,070,197 L333F probably damaging Het
Ikbkap T A 4: 56,779,636 probably null Het
Il6 C T 5: 30,013,504 Q33* probably null Het
Iqgap1 T C 7: 80,751,953 E468G probably benign Het
Iqgap1 A G 7: 80,759,903 I228T possibly damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Kcnj10 A T 1: 172,369,888 Y323F possibly damaging Het
Klk1b5 T C 7: 44,219,898 probably null Het
Lmo7 A G 14: 101,920,515 probably benign Het
Loxhd1 A T 18: 77,356,166 T277S possibly damaging Het
Lrp5 A T 19: 3,614,339 M796K probably benign Het
Med15 A T 16: 17,685,451 probably null Het
Mfn1 T A 3: 32,542,826 H144Q probably damaging Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nrxn2 T C 19: 6,504,914 I1141T probably damaging Het
Olah T C 2: 3,365,269 S9G probably benign Het
Olfr1054 A C 2: 86,332,528 F276C probably damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr1477 T G 19: 13,502,488 I48M probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Otog T A 7: 46,302,904 C2591S probably damaging Het
Pdgfrb G T 18: 61,072,756 V605F probably damaging Het
Pik3cb T A 9: 99,101,244 K104* probably null Het
Plb1 T A 5: 32,314,089 I580N probably damaging Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Plekha7 T A 7: 116,175,767 Y213F probably damaging Het
Plin5 T C 17: 56,116,836 D33G probably benign Het
Pnpla2 C A 7: 141,459,219 Q371K probably damaging Het
Ppm1n A G 7: 19,278,185 Y348H probably damaging Het
Ppp2r1b T A 9: 50,866,554 D266E probably damaging Het
Prss23 A G 7: 89,509,911 S317P probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Pum1 G T 4: 130,751,491 A571S probably damaging Het
Rexo1 G T 10: 80,544,109 C13* probably null Het
Rhpn1 A T 15: 75,704,394 M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripk2 A G 4: 16,132,775 probably null Het
Rps6kc1 T C 1: 190,798,723 Y937C probably damaging Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Ryr2 A G 13: 11,577,873 I4665T possibly damaging Het
Sbno1 C A 5: 124,378,543 V1256F probably benign Het
Senp5 T C 16: 31,968,874 I644V probably damaging Het
Serpinb9e T A 13: 33,252,978 F94I probably damaging Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Sned1 T A 1: 93,274,657 D674E probably benign Het
Sorl1 T C 9: 41,984,492 H1789R probably benign Het
Sp2 T C 11: 96,962,008 D30G possibly damaging Het
Stk33 T A 7: 109,341,320 N61I probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tnfrsf21 A G 17: 43,087,872 D623G probably damaging Het
Trib2 A G 12: 15,793,829 F271L probably damaging Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yeats2 T A 16: 20,154,166 D23E probably damaging Het
Zan T A 5: 137,436,400 I2214F unknown Het
Zbtb40 T C 4: 136,991,635 D917G probably damaging Het
Zcchc2 C A 1: 106,021,723 probably null Het
Zdhhc23 G T 16: 43,973,919 Q131K probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp532 A G 18: 65,624,927 T644A possibly damaging Het
Other mutations in Capns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Capns1 APN 7 30190140 missense probably benign 0.00
IGL01128:Capns1 APN 7 30190133 missense probably benign 0.00
IGL02175:Capns1 APN 7 30190532 missense probably benign 0.28
IGL02966:Capns1 APN 7 30192193 missense probably damaging 1.00
IGL02799:Capns1 UTSW 7 30192219 missense probably benign 0.05
R0578:Capns1 UTSW 7 30194028 unclassified probably benign
R1484:Capns1 UTSW 7 30194086 unclassified probably benign
R5111:Capns1 UTSW 7 30192519 missense probably benign
R5323:Capns1 UTSW 7 30187722 missense possibly damaging 0.85
R5350:Capns1 UTSW 7 30190126 missense probably damaging 1.00
R6684:Capns1 UTSW 7 30193899 missense probably damaging 0.98
R7573:Capns1 UTSW 7 30192535 missense probably damaging 1.00
R7611:Capns1 UTSW 7 30190114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCCCCAAAAGGATACATC -3'
(R):5'- AGTCCGTCAGTTCAGGAAAC -3'

Sequencing Primer
(F):5'- GGATACATCCATGACGGCC -3'
(R):5'- CAGGAAACTTTTTGTCCAGCTG -3'
Posted On2014-10-01