Incidental Mutation 'R2153:Erich1'
ID 234516
Institutional Source Beutler Lab
Gene Symbol Erich1
Ensembl Gene ENSMUSG00000051978
Gene Name glutamate rich 1
Synonyms
MMRRC Submission 040156-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R2153 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 14077561-14140301 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14128773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 56 (T56A)
Ref Sequence ENSEMBL: ENSMUSP00000147614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110813] [ENSMUST00000211242]
AlphaFold E9PY43
Predicted Effect probably benign
Transcript: ENSMUST00000110813
AA Change: T56A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106436
Gene: ENSMUSG00000051978
AA Change: T56A

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 188 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211242
AA Change: T56A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,208,959 (GRCm39) E363G probably benign Het
Abcg2 T A 6: 58,661,307 (GRCm39) probably null Het
Adgrg7 T G 16: 56,572,791 (GRCm39) I342L possibly damaging Het
Akap6 A C 12: 53,188,187 (GRCm39) D1867A probably benign Het
Ankrd17 A T 5: 90,381,918 (GRCm39) V2416D probably damaging Het
Apaf1 A G 10: 90,883,952 (GRCm39) V670A probably damaging Het
Art5 A G 7: 101,747,407 (GRCm39) L124P possibly damaging Het
Atad5 T A 11: 79,997,203 (GRCm39) D842E probably benign Het
Brd10 T C 19: 29,694,229 (GRCm39) M1755V probably benign Het
Capns1 A G 7: 29,891,765 (GRCm39) L124P probably damaging Het
Carmil1 A G 13: 24,325,656 (GRCm39) S225P probably damaging Het
Cars2 C T 8: 11,580,299 (GRCm39) A247T possibly damaging Het
Cd46 A G 1: 194,744,721 (GRCm39) I339T probably benign Het
Ceacam14 C A 7: 17,548,153 (GRCm39) T81N probably benign Het
Ceacam16 G A 7: 19,595,066 (GRCm39) P4L probably benign Het
Chek1 C A 9: 36,635,279 (GRCm39) V35F probably damaging Het
Cntnap5c A T 17: 58,362,666 (GRCm39) I340L possibly damaging Het
Col2a1 C A 15: 97,885,461 (GRCm39) A461S unknown Het
Comtd1 T C 14: 21,898,340 (GRCm39) E27G possibly damaging Het
Cyp2a12 A G 7: 26,732,042 (GRCm39) N261S probably benign Het
Dclk1 A G 3: 55,154,633 (GRCm39) Y21C probably damaging Het
Dis3l T A 9: 64,214,545 (GRCm39) N981I probably benign Het
Dlg5 A T 14: 24,187,225 (GRCm39) I1819N probably damaging Het
Elp1 T A 4: 56,779,636 (GRCm39) probably null Het
Enpep T C 3: 129,074,231 (GRCm39) N772S probably damaging Het
Ermp1 T C 19: 29,614,798 (GRCm39) probably null Het
Etl4 A G 2: 20,803,545 (GRCm39) E807G probably benign Het
Fat4 A T 3: 39,037,544 (GRCm39) Y3732F probably damaging Het
Fbxw18 T G 9: 109,522,438 (GRCm39) T144P probably damaging Het
Flywch1 A T 17: 23,974,624 (GRCm39) I672K probably benign Het
Foxk2 C A 11: 121,151,213 (GRCm39) A86E probably benign Het
Garem2 T C 5: 30,313,297 (GRCm39) S54P probably damaging Het
Gda A G 19: 21,374,869 (GRCm39) probably null Het
Gna15 T C 10: 81,338,738 (GRCm39) Y367C probably damaging Het
Golga3 A G 5: 110,335,856 (GRCm39) probably null Het
Greb1 T C 12: 16,749,533 (GRCm39) S1098G probably damaging Het
Hook3 C A 8: 26,560,225 (GRCm39) L333F probably damaging Het
Il6 C T 5: 30,218,502 (GRCm39) Q33* probably null Het
Iqgap1 T C 7: 80,401,701 (GRCm39) E468G probably benign Het
Iqgap1 A G 7: 80,409,651 (GRCm39) I228T possibly damaging Het
Kat6b A T 14: 21,718,735 (GRCm39) H1138L probably benign Het
Kcnab1 A T 3: 65,278,861 (GRCm39) I371F probably damaging Het
Kcnj10 A T 1: 172,197,455 (GRCm39) Y323F possibly damaging Het
Klk1b5 T C 7: 43,869,322 (GRCm39) probably null Het
Lmo7 A G 14: 102,157,951 (GRCm39) probably benign Het
Loxhd1 A T 18: 77,443,862 (GRCm39) T277S possibly damaging Het
Lrp5 A T 19: 3,664,339 (GRCm39) M796K probably benign Het
Med15 A T 16: 17,503,315 (GRCm39) probably null Het
Mfn1 T A 3: 32,596,975 (GRCm39) H144Q probably damaging Het
Mmp25 T A 17: 23,850,048 (GRCm39) Y504F probably damaging Het
Nmi T C 2: 51,842,555 (GRCm39) E179G probably damaging Het
Nrxn2 T C 19: 6,554,944 (GRCm39) I1141T probably damaging Het
Olah T C 2: 3,366,306 (GRCm39) S9G probably benign Het
Or1m1 T C 9: 18,666,391 (GRCm39) D180G probably damaging Het
Or4c106 C A 2: 88,683,128 (GRCm39) P278H probably damaging Het
Or5b120 T G 19: 13,479,852 (GRCm39) I48M probably damaging Het
Or8b49 G T 9: 38,505,707 (GRCm39) L63F probably damaging Het
Or8k22 A C 2: 86,162,872 (GRCm39) F276C probably damaging Het
Otog T A 7: 45,952,328 (GRCm39) C2591S probably damaging Het
Pdgfrb G T 18: 61,205,828 (GRCm39) V605F probably damaging Het
Pik3cb T A 9: 98,983,297 (GRCm39) K104* probably null Het
Plb1 T A 5: 32,471,433 (GRCm39) I580N probably damaging Het
Plekha2 T C 8: 25,578,413 (GRCm39) Y29C probably damaging Het
Plekha7 T A 7: 115,775,002 (GRCm39) Y213F probably damaging Het
Plin5 T C 17: 56,423,836 (GRCm39) D33G probably benign Het
Pnpla2 C A 7: 141,039,132 (GRCm39) Q371K probably damaging Het
Ppm1n A G 7: 19,012,110 (GRCm39) Y348H probably damaging Het
Ppp2r1b T A 9: 50,777,854 (GRCm39) D266E probably damaging Het
Prss23 A G 7: 89,159,119 (GRCm39) S317P probably damaging Het
Prss33 C T 17: 24,053,817 (GRCm39) V87M probably damaging Het
Ptpn12 C A 5: 21,207,466 (GRCm39) Q297H probably damaging Het
Pum1 G T 4: 130,478,802 (GRCm39) A571S probably damaging Het
Rexo1 G T 10: 80,379,943 (GRCm39) C13* probably null Het
Rhpn1 A T 15: 75,576,243 (GRCm39) M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Ripk2 A G 4: 16,132,775 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,530,920 (GRCm39) Y937C probably damaging Het
Rrbp1 A G 2: 143,796,118 (GRCm39) L1200P possibly damaging Het
Ryr2 A G 13: 11,592,759 (GRCm39) I4665T possibly damaging Het
Sbno1 C A 5: 124,516,606 (GRCm39) V1256F probably benign Het
Senp5 T C 16: 31,787,692 (GRCm39) I644V probably damaging Het
Serpinb9e T A 13: 33,436,961 (GRCm39) F94I probably damaging Het
Sidt2 T C 9: 45,856,638 (GRCm39) D477G probably damaging Het
Slc30a5 A T 13: 100,940,457 (GRCm39) H619Q probably damaging Het
Slmap A G 14: 26,139,402 (GRCm39) Y771H probably damaging Het
Sned1 T A 1: 93,202,379 (GRCm39) D674E probably benign Het
Sorl1 T C 9: 41,895,788 (GRCm39) H1789R probably benign Het
Sp2 T C 11: 96,852,834 (GRCm39) D30G possibly damaging Het
Stk33 T A 7: 108,940,527 (GRCm39) N61I probably benign Het
Stxbp1 T A 2: 32,692,868 (GRCm39) I383F probably damaging Het
Tbcd A G 11: 121,494,457 (GRCm39) Q1006R possibly damaging Het
Tln2 T C 9: 67,209,842 (GRCm39) T432A probably damaging Het
Tnfrsf21 A G 17: 43,398,763 (GRCm39) D623G probably damaging Het
Trib2 A G 12: 15,843,830 (GRCm39) F271L probably damaging Het
Ttn A G 2: 76,810,477 (GRCm39) V17A probably benign Het
Ubqlnl A T 7: 103,797,890 (GRCm39) C536S probably benign Het
Vmn1r230 T A 17: 21,067,063 (GRCm39) M84K probably damaging Het
Vmn2r97 A T 17: 19,167,584 (GRCm39) R613* probably null Het
Yeats2 T A 16: 19,972,916 (GRCm39) D23E probably damaging Het
Zan T A 5: 137,434,662 (GRCm39) I2214F unknown Het
Zbtb40 T C 4: 136,718,946 (GRCm39) D917G probably damaging Het
Zcchc2 C A 1: 105,949,453 (GRCm39) probably null Het
Zdhhc23 G T 16: 43,794,282 (GRCm39) Q131K probably benign Het
Zfp345 T C 2: 150,314,578 (GRCm39) T320A probably benign Het
Zfp532 A G 18: 65,757,998 (GRCm39) T644A possibly damaging Het
Other mutations in Erich1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Erich1 APN 8 14,083,770 (GRCm39) splice site probably benign
IGL00927:Erich1 APN 8 14,083,518 (GRCm39) missense probably damaging 1.00
IGL01448:Erich1 APN 8 14,128,853 (GRCm39) missense possibly damaging 0.95
R1165:Erich1 UTSW 8 14,140,530 (GRCm39) unclassified probably benign
R1541:Erich1 UTSW 8 14,080,688 (GRCm39) missense probably damaging 0.97
R1699:Erich1 UTSW 8 14,140,259 (GRCm39) missense possibly damaging 0.73
R2094:Erich1 UTSW 8 14,140,527 (GRCm39) unclassified probably benign
R3807:Erich1 UTSW 8 14,083,695 (GRCm39) missense probably benign 0.11
R5787:Erich1 UTSW 8 14,083,776 (GRCm39) splice site probably null
R6119:Erich1 UTSW 8 14,083,692 (GRCm39) missense probably benign
R7034:Erich1 UTSW 8 14,114,330 (GRCm39) missense probably benign 0.02
R7363:Erich1 UTSW 8 14,083,688 (GRCm39) missense probably benign 0.05
R7687:Erich1 UTSW 8 14,080,691 (GRCm39) missense probably damaging 0.99
R9087:Erich1 UTSW 8 14,083,623 (GRCm39) missense probably damaging 0.99
R9376:Erich1 UTSW 8 14,080,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATCCCCTCCATTGAGTC -3'
(R):5'- GCCTTTGTTTTGAATGGAAGCCC -3'

Sequencing Primer
(F):5'- CCTCCATTGAGTCACACTGTATGTG -3'
(R):5'- GAATGGAAGCCCTATGTGATTTAAG -3'
Posted On 2014-10-01