Incidental Mutation 'R2153:Sidt2'
ID234524
Institutional Source Beutler Lab
Gene Symbol Sidt2
Ensembl Gene ENSMUSG00000034908
Gene NameSID1 transmembrane family, member 2
SynonymsCGI-40
MMRRC Submission 040156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2153 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45937857-45955258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45945340 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 477 (D477G)
Ref Sequence ENSEMBL: ENSMUSP00000124750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038488] [ENSMUST00000114573] [ENSMUST00000160138] [ENSMUST00000160618] [ENSMUST00000162072] [ENSMUST00000162379] [ENSMUST00000162529]
Predicted Effect probably damaging
Transcript: ENSMUST00000038488
AA Change: D433G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044290
Gene: ENSMUSG00000034908
AA Change: D433G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 832 8.5e-214 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114573
AA Change: D454G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110220
Gene: ENSMUSG00000034908
AA Change: D454G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 853 9e-290 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159033
SMART Domains Protein: ENSMUSP00000125273
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:SID-1_RNA_chan 30 74 1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160138
AA Change: D156G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124945
Gene: ENSMUSG00000034908
AA Change: D156G

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160598
Predicted Effect probably damaging
Transcript: ENSMUST00000160618
AA Change: D61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125037
Gene: ENSMUSG00000034908
AA Change: D61G

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160927
Predicted Effect probably benign
Transcript: ENSMUST00000161042
SMART Domains Protein: ENSMUSP00000124577
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161606
SMART Domains Protein: ENSMUSP00000125660
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 221 4.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162072
AA Change: D477G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124750
Gene: ENSMUSG00000034908
AA Change: D477G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 338 2.3e-34 PFAM
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162379
SMART Domains Protein: ENSMUSP00000124503
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 3.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162529
SMART Domains Protein: ENSMUSP00000125060
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 9.2e-20 PFAM
low complexity region 202 213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit male-specific decreased body weight and size, impaired glucose tolerance, increased serum glucose, decreased serum insulin and decreased insule granule release from beta cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
9930021J03Rik T C 19: 29,716,829 M1755V probably benign Het
Abcg2 T A 6: 58,684,322 probably null Het
Adgrg7 T G 16: 56,752,428 I342L possibly damaging Het
Akap6 A C 12: 53,141,404 D1867A probably benign Het
Ankrd17 A T 5: 90,234,059 V2416D probably damaging Het
Apaf1 A G 10: 91,048,090 V670A probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Atad5 T A 11: 80,106,377 D842E probably benign Het
Capns1 A G 7: 30,192,340 L124P probably damaging Het
Carmil1 A G 13: 24,141,673 S225P probably damaging Het
Cars2 C T 8: 11,530,299 A247T possibly damaging Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Ceacam14 C A 7: 17,814,228 T81N probably benign Het
Ceacam16 G A 7: 19,861,141 P4L probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntnap5c A T 17: 58,055,671 I340L possibly damaging Het
Col2a1 C A 15: 97,987,580 A461S unknown Het
Comtd1 T C 14: 21,848,272 E27G possibly damaging Het
Cyp2a12 A G 7: 27,032,617 N261S probably benign Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dlg5 A T 14: 24,137,157 I1819N probably damaging Het
Enpep T C 3: 129,280,582 N772S probably damaging Het
Erich1 T C 8: 14,078,773 T56A probably benign Het
Ermp1 T C 19: 29,637,398 probably null Het
Etl4 A G 2: 20,798,734 E807G probably benign Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fbxw18 T G 9: 109,693,370 T144P probably damaging Het
Flywch1 A T 17: 23,755,650 I672K probably benign Het
Foxk2 C A 11: 121,260,387 A86E probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gda A G 19: 21,397,505 probably null Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Golga3 A G 5: 110,187,990 probably null Het
Greb1 T C 12: 16,699,532 S1098G probably damaging Het
Hook3 C A 8: 26,070,197 L333F probably damaging Het
Ikbkap T A 4: 56,779,636 probably null Het
Il6 C T 5: 30,013,504 Q33* probably null Het
Iqgap1 T C 7: 80,751,953 E468G probably benign Het
Iqgap1 A G 7: 80,759,903 I228T possibly damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Kcnj10 A T 1: 172,369,888 Y323F possibly damaging Het
Klk1b5 T C 7: 44,219,898 probably null Het
Lmo7 A G 14: 101,920,515 probably benign Het
Loxhd1 A T 18: 77,356,166 T277S possibly damaging Het
Lrp5 A T 19: 3,614,339 M796K probably benign Het
Med15 A T 16: 17,685,451 probably null Het
Mfn1 T A 3: 32,542,826 H144Q probably damaging Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nrxn2 T C 19: 6,504,914 I1141T probably damaging Het
Olah T C 2: 3,365,269 S9G probably benign Het
Olfr1054 A C 2: 86,332,528 F276C probably damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr1477 T G 19: 13,502,488 I48M probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Otog T A 7: 46,302,904 C2591S probably damaging Het
Pdgfrb G T 18: 61,072,756 V605F probably damaging Het
Pik3cb T A 9: 99,101,244 K104* probably null Het
Plb1 T A 5: 32,314,089 I580N probably damaging Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Plekha7 T A 7: 116,175,767 Y213F probably damaging Het
Plin5 T C 17: 56,116,836 D33G probably benign Het
Pnpla2 C A 7: 141,459,219 Q371K probably damaging Het
Ppm1n A G 7: 19,278,185 Y348H probably damaging Het
Ppp2r1b T A 9: 50,866,554 D266E probably damaging Het
Prss23 A G 7: 89,509,911 S317P probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Pum1 G T 4: 130,751,491 A571S probably damaging Het
Rexo1 G T 10: 80,544,109 C13* probably null Het
Rhpn1 A T 15: 75,704,394 M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripk2 A G 4: 16,132,775 probably null Het
Rps6kc1 T C 1: 190,798,723 Y937C probably damaging Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Ryr2 A G 13: 11,577,873 I4665T possibly damaging Het
Sbno1 C A 5: 124,378,543 V1256F probably benign Het
Senp5 T C 16: 31,968,874 I644V probably damaging Het
Serpinb9e T A 13: 33,252,978 F94I probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Sned1 T A 1: 93,274,657 D674E probably benign Het
Sorl1 T C 9: 41,984,492 H1789R probably benign Het
Sp2 T C 11: 96,962,008 D30G possibly damaging Het
Stk33 T A 7: 109,341,320 N61I probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tnfrsf21 A G 17: 43,087,872 D623G probably damaging Het
Trib2 A G 12: 15,793,829 F271L probably damaging Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yeats2 T A 16: 20,154,166 D23E probably damaging Het
Zan T A 5: 137,436,400 I2214F unknown Het
Zbtb40 T C 4: 136,991,635 D917G probably damaging Het
Zcchc2 C A 1: 106,021,723 probably null Het
Zdhhc23 G T 16: 43,973,919 Q131K probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp532 A G 18: 65,624,927 T644A possibly damaging Het
Other mutations in Sidt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Sidt2 APN 9 45942236 missense possibly damaging 0.84
IGL00586:Sidt2 APN 9 45943052 missense possibly damaging 0.78
IGL00786:Sidt2 APN 9 45949803 missense possibly damaging 0.69
IGL01069:Sidt2 APN 9 45943077 missense possibly damaging 0.73
IGL01160:Sidt2 APN 9 45942726 missense probably damaging 1.00
IGL01474:Sidt2 APN 9 45946982 critical splice donor site probably null
IGL02068:Sidt2 APN 9 45945664 critical splice donor site probably null
IGL02171:Sidt2 APN 9 45952770 missense possibly damaging 0.81
IGL02312:Sidt2 APN 9 45947001 missense probably benign 0.27
IGL02344:Sidt2 APN 9 45945292 missense probably null 1.00
IGL03030:Sidt2 APN 9 45939505 missense probably damaging 1.00
IGL03062:Sidt2 APN 9 45942683 critical splice donor site probably null
R0157:Sidt2 UTSW 9 45939267 missense probably damaging 1.00
R0330:Sidt2 UTSW 9 45954902 missense probably benign 0.09
R0549:Sidt2 UTSW 9 45953119 splice site probably null
R0714:Sidt2 UTSW 9 45947060 splice site probably benign
R1241:Sidt2 UTSW 9 45945704 missense probably damaging 0.97
R1511:Sidt2 UTSW 9 45950089 missense probably damaging 1.00
R1558:Sidt2 UTSW 9 45951800 missense probably damaging 1.00
R1677:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R2152:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2154:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R4210:Sidt2 UTSW 9 45942775 missense probably benign 0.00
R4349:Sidt2 UTSW 9 45945713 missense possibly damaging 0.94
R4855:Sidt2 UTSW 9 45952029 missense probably benign
R5069:Sidt2 UTSW 9 45939461 unclassified probably null
R5175:Sidt2 UTSW 9 45951788 missense probably damaging 1.00
R5276:Sidt2 UTSW 9 45954777 missense probably damaging 0.97
R5544:Sidt2 UTSW 9 45944455 missense probably damaging 1.00
R5805:Sidt2 UTSW 9 45942199 missense probably damaging 0.97
R5927:Sidt2 UTSW 9 45944454 missense probably damaging 1.00
R6954:Sidt2 UTSW 9 45952850 missense probably benign 0.01
R7060:Sidt2 UTSW 9 45953246 missense possibly damaging 0.91
R7117:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R7207:Sidt2 UTSW 9 45945151 missense probably damaging 1.00
R7317:Sidt2 UTSW 9 45943690 nonsense probably null
X0026:Sidt2 UTSW 9 45939299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGAGTTACAGACCAAGACC -3'
(R):5'- TGGCGAATCACTGTGCTGTG -3'

Sequencing Primer
(F):5'- GTGATCACCAGCTGCACC -3'
(R):5'- GACCGACTCCAGGAGAAGTC -3'
Posted On2014-10-01