Incidental Mutation 'R2153:Ppp2r1b'
ID234525
Institutional Source Beutler Lab
Gene Symbol Ppp2r1b
Ensembl Gene ENSMUSG00000032058
Gene Nameprotein phosphatase 2, regulatory subunit A, beta
Synonyms2410091N08Rik
MMRRC Submission 040156-MU
Accession Numbers

Ncbi RefSeq: NM_001034085.1, NM_028614.2; MGI:1920949

Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R2153 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location50845301-50894229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50866554 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 266 (D266E)
Ref Sequence ENSEMBL: ENSMUSP00000135525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034560] [ENSMUST00000114437] [ENSMUST00000174628] [ENSMUST00000175640] [ENSMUST00000175645] [ENSMUST00000175926] [ENSMUST00000176055] [ENSMUST00000176349] [ENSMUST00000176798]
Predicted Effect probably damaging
Transcript: ENSMUST00000034560
AA Change: D266E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034560
Gene: ENSMUSG00000032058
AA Change: D266E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.2e-6 PFAM
Pfam:HEAT_EZ 182 243 9.9e-6 PFAM
Pfam:HEAT 295 325 5.9e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114437
AA Change: D266E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110080
Gene: ENSMUSG00000032058
AA Change: D266E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 1.6e-6 PFAM
Pfam:HEAT_EZ 180 243 7.3e-6 PFAM
Pfam:HEAT 217 247 4.3e-5 PFAM
Pfam:HEAT 295 325 4.2e-6 PFAM
Pfam:HEAT_2 378 479 9e-11 PFAM
Pfam:HEAT_2 494 597 4.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174555
Predicted Effect probably damaging
Transcript: ENSMUST00000174628
AA Change: D266E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133404
Gene: ENSMUSG00000032058
AA Change: D266E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 4.6e-6 PFAM
Pfam:HEAT 217 247 4.5e-5 PFAM
Pfam:HEAT 295 325 4.3e-6 PFAM
Pfam:HEAT_2 378 479 1.7e-11 PFAM
low complexity region 643 655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175640
AA Change: D139E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134740
Gene: ENSMUSG00000032058
AA Change: D139E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 129 159 5.7e-5 PFAM
Pfam:HEAT 168 198 4e-6 PFAM
Pfam:HEAT_2 251 352 6.3e-11 PFAM
Pfam:HEAT_2 365 470 3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175645
AA Change: D266E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135871
Gene: ENSMUSG00000032058
AA Change: D266E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT_EZ 173 243 8e-6 PFAM
Pfam:HEAT 178 208 1.8e-6 PFAM
Pfam:HEAT 217 247 4.9e-5 PFAM
Pfam:HEAT 295 325 4.8e-6 PFAM
Pfam:HEAT_2 449 552 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175926
SMART Domains Protein: ENSMUSP00000134886
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
SCOP:d1b3ua_ 14 104 4e-15 SMART
PDB:3DW8|D 22 104 4e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176055
SMART Domains Protein: ENSMUSP00000135253
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
PDB:3DW8|D 1 51 1e-26 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000176349
AA Change: D202E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135758
Gene: ENSMUSG00000032058
AA Change: D202E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 114 144 2e-6 PFAM
Pfam:HEAT_EZ 116 179 8.7e-6 PFAM
Pfam:HEAT 153 183 5.5e-5 PFAM
Pfam:HEAT 231 261 5.3e-6 PFAM
Pfam:HEAT_2 314 415 9.3e-11 PFAM
Pfam:HEAT_2 430 532 4.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176798
AA Change: D266E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135525
Gene: ENSMUSG00000032058
AA Change: D266E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.3e-6 PFAM
Pfam:HEAT_EZ 182 243 1e-5 PFAM
Pfam:HEAT 295 325 6e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
9930021J03Rik T C 19: 29,716,829 M1755V probably benign Het
Abcg2 T A 6: 58,684,322 probably null Het
Adgrg7 T G 16: 56,752,428 I342L possibly damaging Het
Akap6 A C 12: 53,141,404 D1867A probably benign Het
Ankrd17 A T 5: 90,234,059 V2416D probably damaging Het
Apaf1 A G 10: 91,048,090 V670A probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Atad5 T A 11: 80,106,377 D842E probably benign Het
Capns1 A G 7: 30,192,340 L124P probably damaging Het
Carmil1 A G 13: 24,141,673 S225P probably damaging Het
Cars2 C T 8: 11,530,299 A247T possibly damaging Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Ceacam14 C A 7: 17,814,228 T81N probably benign Het
Ceacam16 G A 7: 19,861,141 P4L probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntnap5c A T 17: 58,055,671 I340L possibly damaging Het
Col2a1 C A 15: 97,987,580 A461S unknown Het
Comtd1 T C 14: 21,848,272 E27G possibly damaging Het
Cyp2a12 A G 7: 27,032,617 N261S probably benign Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dlg5 A T 14: 24,137,157 I1819N probably damaging Het
Enpep T C 3: 129,280,582 N772S probably damaging Het
Erich1 T C 8: 14,078,773 T56A probably benign Het
Ermp1 T C 19: 29,637,398 probably null Het
Etl4 A G 2: 20,798,734 E807G probably benign Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fbxw18 T G 9: 109,693,370 T144P probably damaging Het
Flywch1 A T 17: 23,755,650 I672K probably benign Het
Foxk2 C A 11: 121,260,387 A86E probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gda A G 19: 21,397,505 probably null Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Golga3 A G 5: 110,187,990 probably null Het
Greb1 T C 12: 16,699,532 S1098G probably damaging Het
Hook3 C A 8: 26,070,197 L333F probably damaging Het
Ikbkap T A 4: 56,779,636 probably null Het
Il6 C T 5: 30,013,504 Q33* probably null Het
Iqgap1 T C 7: 80,751,953 E468G probably benign Het
Iqgap1 A G 7: 80,759,903 I228T possibly damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Kcnj10 A T 1: 172,369,888 Y323F possibly damaging Het
Klk1b5 T C 7: 44,219,898 probably null Het
Lmo7 A G 14: 101,920,515 probably benign Het
Loxhd1 A T 18: 77,356,166 T277S possibly damaging Het
Lrp5 A T 19: 3,614,339 M796K probably benign Het
Med15 A T 16: 17,685,451 probably null Het
Mfn1 T A 3: 32,542,826 H144Q probably damaging Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nrxn2 T C 19: 6,504,914 I1141T probably damaging Het
Olah T C 2: 3,365,269 S9G probably benign Het
Olfr1054 A C 2: 86,332,528 F276C probably damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr1477 T G 19: 13,502,488 I48M probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Otog T A 7: 46,302,904 C2591S probably damaging Het
Pdgfrb G T 18: 61,072,756 V605F probably damaging Het
Pik3cb T A 9: 99,101,244 K104* probably null Het
Plb1 T A 5: 32,314,089 I580N probably damaging Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Plekha7 T A 7: 116,175,767 Y213F probably damaging Het
Plin5 T C 17: 56,116,836 D33G probably benign Het
Pnpla2 C A 7: 141,459,219 Q371K probably damaging Het
Ppm1n A G 7: 19,278,185 Y348H probably damaging Het
Prss23 A G 7: 89,509,911 S317P probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Pum1 G T 4: 130,751,491 A571S probably damaging Het
Rexo1 G T 10: 80,544,109 C13* probably null Het
Rhpn1 A T 15: 75,704,394 M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripk2 A G 4: 16,132,775 probably null Het
Rps6kc1 T C 1: 190,798,723 Y937C probably damaging Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Ryr2 A G 13: 11,577,873 I4665T possibly damaging Het
Sbno1 C A 5: 124,378,543 V1256F probably benign Het
Senp5 T C 16: 31,968,874 I644V probably damaging Het
Serpinb9e T A 13: 33,252,978 F94I probably damaging Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Sned1 T A 1: 93,274,657 D674E probably benign Het
Sorl1 T C 9: 41,984,492 H1789R probably benign Het
Sp2 T C 11: 96,962,008 D30G possibly damaging Het
Stk33 T A 7: 109,341,320 N61I probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tnfrsf21 A G 17: 43,087,872 D623G probably damaging Het
Trib2 A G 12: 15,793,829 F271L probably damaging Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yeats2 T A 16: 20,154,166 D23E probably damaging Het
Zan T A 5: 137,436,400 I2214F unknown Het
Zbtb40 T C 4: 136,991,635 D917G probably damaging Het
Zcchc2 C A 1: 106,021,723 probably null Het
Zdhhc23 G T 16: 43,973,919 Q131K probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp532 A G 18: 65,624,927 T644A possibly damaging Het
Other mutations in Ppp2r1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL01623:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL02120:Ppp2r1b APN 9 50861769 splice site probably benign
IGL02158:Ppp2r1b APN 9 50861609 missense probably benign 0.02
IGL02706:Ppp2r1b APN 9 50878834 missense possibly damaging 0.83
IGL02801:Ppp2r1b APN 9 50878827 missense probably benign 0.00
IGL02943:Ppp2r1b APN 9 50883585 missense probably damaging 1.00
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0211:Ppp2r1b UTSW 9 50861625 missense probably benign 0.00
R0603:Ppp2r1b UTSW 9 50861685 missense probably damaging 1.00
R1219:Ppp2r1b UTSW 9 50867321 splice site probably benign
R1513:Ppp2r1b UTSW 9 50870145 missense probably damaging 1.00
R1545:Ppp2r1b UTSW 9 50862425 missense possibly damaging 0.68
R1997:Ppp2r1b UTSW 9 50867371 missense possibly damaging 0.71
R1998:Ppp2r1b UTSW 9 50883585 missense probably damaging 1.00
R3829:Ppp2r1b UTSW 9 50862494 missense probably benign 0.02
R4672:Ppp2r1b UTSW 9 50867719 missense probably damaging 0.99
R5299:Ppp2r1b UTSW 9 50857040 missense probably benign 0.04
R5376:Ppp2r1b UTSW 9 50866928 missense possibly damaging 0.78
R5504:Ppp2r1b UTSW 9 50858887 missense probably damaging 1.00
R5700:Ppp2r1b UTSW 9 50878157 missense probably damaging 1.00
R5771:Ppp2r1b UTSW 9 50866832 missense probably damaging 0.98
R7547:Ppp2r1b UTSW 9 50862462 missense probably benign 0.06
R7626:Ppp2r1b UTSW 9 50878176 missense possibly damaging 0.91
Z1088:Ppp2r1b UTSW 9 50866911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGTACCTGTGGCAGCAGTC -3'
(R):5'- TCATCAAAAGCATGCTGTAACC -3'

Sequencing Primer
(F):5'- TGTGGCAGCAGTCTCTCAC -3'
(R):5'- TGGAAAGATTAAGCAGGCTCTCTCAC -3'
Posted On2014-10-01