Mutagenetix > Incidental Mutation

Incidental Mutation 'R2153:Tln2'

234527

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

040156-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R2153 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67302560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 432 (T432A)

Ref Sequence

ENSEMBL: ENSMUSP00000149474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039662
AA Change: T1518A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: T1518A

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040025
AA Change: T1518A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: T1518A

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215267
AA Change: T428A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215784
AA Change: T1520A

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217550
AA Change: T432A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,455,115	E363G	probably benign	Het
9930021J03Rik	T	C	19: 29,716,829	M1755V	probably benign	Het
Abcg2	T	A	6: 58,684,322		probably null	Het
Adgrg7	T	G	16: 56,752,428	I342L	possibly damaging	Het
Akap6	A	C	12: 53,141,404	D1867A	probably benign	Het
Ankrd17	A	T	5: 90,234,059	V2416D	probably damaging	Het
Apaf1	A	G	10: 91,048,090	V670A	probably damaging	Het
Art5	A	G	7: 102,098,200	L124P	possibly damaging	Het
Atad5	T	A	11: 80,106,377	D842E	probably benign	Het
Capns1	A	G	7: 30,192,340	L124P	probably damaging	Het
Carmil1	A	G	13: 24,141,673	S225P	probably damaging	Het
Cars2	C	T	8: 11,530,299	A247T	possibly damaging	Het
Cd46	A	G	1: 195,062,413	I339T	probably benign	Het
Ceacam14	C	A	7: 17,814,228	T81N	probably benign	Het
Ceacam16	G	A	7: 19,861,141	P4L	probably benign	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cntnap5c	A	T	17: 58,055,671	I340L	possibly damaging	Het
Col2a1	C	A	15: 97,987,580	A461S	unknown	Het
Comtd1	T	C	14: 21,848,272	E27G	possibly damaging	Het
Cyp2a12	A	G	7: 27,032,617	N261S	probably benign	Het
Dclk1	A	G	3: 55,247,212	Y21C	probably damaging	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dlg5	A	T	14: 24,137,157	I1819N	probably damaging	Het
Enpep	T	C	3: 129,280,582	N772S	probably damaging	Het
Erich1	T	C	8: 14,078,773	T56A	probably benign	Het
Ermp1	T	C	19: 29,637,398		probably null	Het
Etl4	A	G	2: 20,798,734	E807G	probably benign	Het
Fat4	A	T	3: 38,983,395	Y3732F	probably damaging	Het
Fbxw18	T	G	9: 109,693,370	T144P	probably damaging	Het
Flywch1	A	T	17: 23,755,650	I672K	probably benign	Het
Foxk2	C	A	11: 121,260,387	A86E	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gda	A	G	19: 21,397,505		probably null	Het
Gna15	T	C	10: 81,502,904	Y367C	probably damaging	Het
Golga3	A	G	5: 110,187,990		probably null	Het
Greb1	T	C	12: 16,699,532	S1098G	probably damaging	Het
Hook3	C	A	8: 26,070,197	L333F	probably damaging	Het
Ikbkap	T	A	4: 56,779,636		probably null	Het
Il6	C	T	5: 30,013,504	Q33*	probably null	Het
Iqgap1	T	C	7: 80,751,953	E468G	probably benign	Het
Iqgap1	A	G	7: 80,759,903	I228T	possibly damaging	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kcnab1	A	T	3: 65,371,440	I371F	probably damaging	Het
Kcnj10	A	T	1: 172,369,888	Y323F	possibly damaging	Het
Klk1b5	T	C	7: 44,219,898		probably null	Het
Lmo7	A	G	14: 101,920,515		probably benign	Het
Loxhd1	A	T	18: 77,356,166	T277S	possibly damaging	Het
Lrp5	A	T	19: 3,614,339	M796K	probably benign	Het
Med15	A	T	16: 17,685,451		probably null	Het
Mfn1	T	A	3: 32,542,826	H144Q	probably damaging	Het
Mmp25	T	A	17: 23,631,074	Y504F	probably damaging	Het
Nmi	T	C	2: 51,952,543	E179G	probably damaging	Het
Nrxn2	T	C	19: 6,504,914	I1141T	probably damaging	Het
Olah	T	C	2: 3,365,269	S9G	probably benign	Het
Olfr1054	A	C	2: 86,332,528	F276C	probably damaging	Het
Olfr1204	C	A	2: 88,852,784	P278H	probably damaging	Het
Olfr1477	T	G	19: 13,502,488	I48M	probably damaging	Het
Olfr24	T	C	9: 18,755,095	D180G	probably damaging	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Otog	T	A	7: 46,302,904	C2591S	probably damaging	Het
Pdgfrb	G	T	18: 61,072,756	V605F	probably damaging	Het
Pik3cb	T	A	9: 99,101,244	K104*	probably null	Het
Plb1	T	A	5: 32,314,089	I580N	probably damaging	Het
Plekha2	T	C	8: 25,088,397	Y29C	probably damaging	Het
Plekha7	T	A	7: 116,175,767	Y213F	probably damaging	Het
Plin5	T	C	17: 56,116,836	D33G	probably benign	Het
Pnpla2	C	A	7: 141,459,219	Q371K	probably damaging	Het
Ppm1n	A	G	7: 19,278,185	Y348H	probably damaging	Het
Ppp2r1b	T	A	9: 50,866,554	D266E	probably damaging	Het
Prss23	A	G	7: 89,509,911	S317P	probably damaging	Het
Prss33	C	T	17: 23,834,843	V87M	probably damaging	Het
Ptpn12	C	A	5: 21,002,468	Q297H	probably damaging	Het
Pum1	G	T	4: 130,751,491	A571S	probably damaging	Het
Rexo1	G	T	10: 80,544,109	C13*	probably null	Het
Rhpn1	A	T	15: 75,704,394	M1L	probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Ripk2	A	G	4: 16,132,775		probably null	Het
Rps6kc1	T	C	1: 190,798,723	Y937C	probably damaging	Het
Rrbp1	A	G	2: 143,954,198	L1200P	possibly damaging	Het
Ryr2	A	G	13: 11,577,873	I4665T	possibly damaging	Het
Sbno1	C	A	5: 124,378,543	V1256F	probably benign	Het
Senp5	T	C	16: 31,968,874	I644V	probably damaging	Het
Serpinb9e	T	A	13: 33,252,978	F94I	probably damaging	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc30a5	A	T	13: 100,803,949	H619Q	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Sned1	T	A	1: 93,274,657	D674E	probably benign	Het
Sorl1	T	C	9: 41,984,492	H1789R	probably benign	Het
Sp2	T	C	11: 96,962,008	D30G	possibly damaging	Het
Stk33	T	A	7: 109,341,320	N61I	probably benign	Het
Stxbp1	T	A	2: 32,802,856	I383F	probably damaging	Het
Tbcd	A	G	11: 121,603,631	Q1006R	possibly damaging	Het
Tnfrsf21	A	G	17: 43,087,872	D623G	probably damaging	Het
Trib2	A	G	12: 15,793,829	F271L	probably damaging	Het
Ttn	A	G	2: 76,980,133	V17A	probably benign	Het
Ubqlnl	A	T	7: 104,148,683	C536S	probably benign	Het
Vmn1r230	T	A	17: 20,846,801	M84K	probably damaging	Het
Vmn2r97	A	T	17: 18,947,322	R613*	probably null	Het
Yeats2	T	A	16: 20,154,166	D23E	probably damaging	Het
Zan	T	A	5: 137,436,400	I2214F	unknown	Het
Zbtb40	T	C	4: 136,991,635	D917G	probably damaging	Het
Zcchc2	C	A	1: 106,021,723		probably null	Het
Zdhhc23	G	T	16: 43,973,919	Q131K	probably benign	Het
Zfp345	T	C	2: 150,472,658	T320A	probably benign	Het
Zfp532	A	G	18: 65,624,927	T644A	possibly damaging	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
Harrier	UTSW	9	67330552	nonsense	probably null
Marsh	UTSW	9	67272654	missense	probably benign	0.19
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0107:Tln2	UTSW	9	67370706	missense	probably damaging	1.00
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1527:Tln2	UTSW	9	67272668	missense	possibly damaging	0.95
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2152:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3116:Tln2	UTSW	9	67355139	missense	probably benign	0.10
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4697:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R7931:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
R8495:Tln2	UTSW	9	67354467	missense	probably benign	0.01
R8734:Tln2	UTSW	9	67272654	missense	probably benign	0.19
R8739:Tln2	UTSW	9	67258273	missense	probably damaging	1.00
R8757:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8759:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8770:Tln2	UTSW	9	67323022	missense	probably benign
R8781:Tln2	UTSW	9	67255951	missense	probably damaging	1.00
R8812:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8814:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221517	missense	probably damaging	1.00
R8833:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8835:Tln2	UTSW	9	67397693	splice site	probably benign
R8837:Tln2	UTSW	9	67250584	missense	probably damaging	0.99
R8843:Tln2	UTSW	9	67395545	missense	probably damaging	1.00
R8864:Tln2	UTSW	9	67330552	nonsense	probably null
R8867:Tln2	UTSW	9	67330550	missense	probably damaging	0.98
R8921:Tln2	UTSW	9	67266823	missense	probably damaging	0.99
R9080:Tln2	UTSW	9	67346561	missense	probably damaging	1.00
R9083:Tln2	UTSW	9	67362645	missense	probably damaging	0.96
R9150:Tln2	UTSW	9	67221496	missense	probably damaging	1.00
R9287:Tln2	UTSW	9	67370698	missense	probably benign	0.20
R9330:Tln2	UTSW	9	67321931	missense	possibly damaging	0.61
R9343:Tln2	UTSW	9	67323071	missense	probably benign	0.10
R9355:Tln2	UTSW	9	67355247	missense	possibly damaging	0.46
R9383:Tln2	UTSW	9	67370761	missense	probably benign	0.17
R9386:Tln2	UTSW	9	67365967	missense	possibly damaging	0.78
R9407:Tln2	UTSW	9	67229450	missense	probably damaging	1.00
R9483:Tln2	UTSW	9	67392487	missense	probably damaging	1.00
R9523:Tln2	UTSW	9	67258484	missense	probably damaging	0.99
R9642:Tln2	UTSW	9	67250544	missense	probably benign	0.02
R9703:Tln2	UTSW	9	67386656	missense	probably damaging	1.00
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CCTGATAAGTAAGTGGAAGCAACC -3'
(R):5'- CAGATTCTGGACATGTGGGC -3'

Sequencing Primer
(F):5'- TCACCTATGACTTAAGGGCTACC -3'
(R):5'- CTGGACATGTGGGCTGCAG -3'

Posted On

2014-10-01