Incidental Mutation 'R2153:Apaf1'
ID234534
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission 040156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2153 (G1)
Quality Score118
Status Not validated
Chromosome10
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91048090 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 670 (V670A)
Ref Sequence ENSEMBL: ENSMUSP00000124134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]
Predicted Effect probably damaging
Transcript: ENSMUST00000020157
AA Change: V681A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: V681A

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159110
AA Change: V681A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: V681A

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162618
AA Change: V670A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: V670A

DomainStartEndE-ValueType
Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
9930021J03Rik T C 19: 29,716,829 M1755V probably benign Het
Abcg2 T A 6: 58,684,322 probably null Het
Adgrg7 T G 16: 56,752,428 I342L possibly damaging Het
Akap6 A C 12: 53,141,404 D1867A probably benign Het
Ankrd17 A T 5: 90,234,059 V2416D probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Atad5 T A 11: 80,106,377 D842E probably benign Het
Capns1 A G 7: 30,192,340 L124P probably damaging Het
Carmil1 A G 13: 24,141,673 S225P probably damaging Het
Cars2 C T 8: 11,530,299 A247T possibly damaging Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Ceacam14 C A 7: 17,814,228 T81N probably benign Het
Ceacam16 G A 7: 19,861,141 P4L probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntnap5c A T 17: 58,055,671 I340L possibly damaging Het
Col2a1 C A 15: 97,987,580 A461S unknown Het
Comtd1 T C 14: 21,848,272 E27G possibly damaging Het
Cyp2a12 A G 7: 27,032,617 N261S probably benign Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dlg5 A T 14: 24,137,157 I1819N probably damaging Het
Enpep T C 3: 129,280,582 N772S probably damaging Het
Erich1 T C 8: 14,078,773 T56A probably benign Het
Ermp1 T C 19: 29,637,398 probably null Het
Etl4 A G 2: 20,798,734 E807G probably benign Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fbxw18 T G 9: 109,693,370 T144P probably damaging Het
Flywch1 A T 17: 23,755,650 I672K probably benign Het
Foxk2 C A 11: 121,260,387 A86E probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gda A G 19: 21,397,505 probably null Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Golga3 A G 5: 110,187,990 probably null Het
Greb1 T C 12: 16,699,532 S1098G probably damaging Het
Hook3 C A 8: 26,070,197 L333F probably damaging Het
Ikbkap T A 4: 56,779,636 probably null Het
Il6 C T 5: 30,013,504 Q33* probably null Het
Iqgap1 T C 7: 80,751,953 E468G probably benign Het
Iqgap1 A G 7: 80,759,903 I228T possibly damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Kcnj10 A T 1: 172,369,888 Y323F possibly damaging Het
Klk1b5 T C 7: 44,219,898 probably null Het
Lmo7 A G 14: 101,920,515 probably benign Het
Loxhd1 A T 18: 77,356,166 T277S possibly damaging Het
Lrp5 A T 19: 3,614,339 M796K probably benign Het
Med15 A T 16: 17,685,451 probably null Het
Mfn1 T A 3: 32,542,826 H144Q probably damaging Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nrxn2 T C 19: 6,504,914 I1141T probably damaging Het
Olah T C 2: 3,365,269 S9G probably benign Het
Olfr1054 A C 2: 86,332,528 F276C probably damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr1477 T G 19: 13,502,488 I48M probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Otog T A 7: 46,302,904 C2591S probably damaging Het
Pdgfrb G T 18: 61,072,756 V605F probably damaging Het
Pik3cb T A 9: 99,101,244 K104* probably null Het
Plb1 T A 5: 32,314,089 I580N probably damaging Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Plekha7 T A 7: 116,175,767 Y213F probably damaging Het
Plin5 T C 17: 56,116,836 D33G probably benign Het
Pnpla2 C A 7: 141,459,219 Q371K probably damaging Het
Ppm1n A G 7: 19,278,185 Y348H probably damaging Het
Ppp2r1b T A 9: 50,866,554 D266E probably damaging Het
Prss23 A G 7: 89,509,911 S317P probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Pum1 G T 4: 130,751,491 A571S probably damaging Het
Rexo1 G T 10: 80,544,109 C13* probably null Het
Rhpn1 A T 15: 75,704,394 M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripk2 A G 4: 16,132,775 probably null Het
Rps6kc1 T C 1: 190,798,723 Y937C probably damaging Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Ryr2 A G 13: 11,577,873 I4665T possibly damaging Het
Sbno1 C A 5: 124,378,543 V1256F probably benign Het
Senp5 T C 16: 31,968,874 I644V probably damaging Het
Serpinb9e T A 13: 33,252,978 F94I probably damaging Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Sned1 T A 1: 93,274,657 D674E probably benign Het
Sorl1 T C 9: 41,984,492 H1789R probably benign Het
Sp2 T C 11: 96,962,008 D30G possibly damaging Het
Stk33 T A 7: 109,341,320 N61I probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tnfrsf21 A G 17: 43,087,872 D623G probably damaging Het
Trib2 A G 12: 15,793,829 F271L probably damaging Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yeats2 T A 16: 20,154,166 D23E probably damaging Het
Zan T A 5: 137,436,400 I2214F unknown Het
Zbtb40 T C 4: 136,991,635 D917G probably damaging Het
Zcchc2 C A 1: 106,021,723 probably null Het
Zdhhc23 G T 16: 43,973,919 Q131K probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp532 A G 18: 65,624,927 T644A possibly damaging Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
wipeout UTSW 10 91056000 missense probably damaging 1.00
R0520:Apaf1 UTSW 10 91079989 missense probably damaging 0.99
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R0734:Apaf1 UTSW 10 91037021 missense probably benign 0.02
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1459:Apaf1 UTSW 10 91062160 missense probably benign 0.00
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2006:Apaf1 UTSW 10 91061772 missense probably damaging 1.00
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5497:Apaf1 UTSW 10 90999656 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7423:Apaf1 UTSW 10 91059606 missense probably damaging 1.00
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
R7765:Apaf1 UTSW 10 91023782 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AACAGGTGTGACTTCAACTCAG -3'
(R):5'- TCCTGTATTTAAGCGGTTGACAG -3'

Sequencing Primer
(F):5'- GTGACTTCAACTCAGAAAGAAAATGC -3'
(R):5'- GTAAGAAAGACTGTGCTGTTGTTAC -3'
Posted On2014-10-01