Incidental Mutation 'R2153:Tbcd'
ID234539
Institutional Source Beutler Lab
Gene Symbol Tbcd
Ensembl Gene ENSMUSG00000039230
Gene Nametubulin-specific chaperone d
Synonyms2310057L06Rik, A030005L14Rik
MMRRC Submission 040156-MU
Accession Numbers

Ncbi RefSeq: NM_029878.3; MGI:1919686

Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R2153 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location121451949-121617164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121603631 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1006 (Q1006R)
Ref Sequence ENSEMBL: ENSMUSP00000099302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103013
AA Change: Q1006R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230
AA Change: Q1006R

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
SCOP:d1b3ua_ 357 742 4e-20 SMART
Pfam:TFCD_C 900 1090 1.4e-74 PFAM
low complexity region 1113 1120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155666
Meta Mutation Damage Score 0.2066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
9930021J03Rik T C 19: 29,716,829 M1755V probably benign Het
Abcg2 T A 6: 58,684,322 probably null Het
Adgrg7 T G 16: 56,752,428 I342L possibly damaging Het
Akap6 A C 12: 53,141,404 D1867A probably benign Het
Ankrd17 A T 5: 90,234,059 V2416D probably damaging Het
Apaf1 A G 10: 91,048,090 V670A probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Atad5 T A 11: 80,106,377 D842E probably benign Het
Capns1 A G 7: 30,192,340 L124P probably damaging Het
Carmil1 A G 13: 24,141,673 S225P probably damaging Het
Cars2 C T 8: 11,530,299 A247T possibly damaging Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Ceacam14 C A 7: 17,814,228 T81N probably benign Het
Ceacam16 G A 7: 19,861,141 P4L probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntnap5c A T 17: 58,055,671 I340L possibly damaging Het
Col2a1 C A 15: 97,987,580 A461S unknown Het
Comtd1 T C 14: 21,848,272 E27G possibly damaging Het
Cyp2a12 A G 7: 27,032,617 N261S probably benign Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dlg5 A T 14: 24,137,157 I1819N probably damaging Het
Enpep T C 3: 129,280,582 N772S probably damaging Het
Erich1 T C 8: 14,078,773 T56A probably benign Het
Ermp1 T C 19: 29,637,398 probably null Het
Etl4 A G 2: 20,798,734 E807G probably benign Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fbxw18 T G 9: 109,693,370 T144P probably damaging Het
Flywch1 A T 17: 23,755,650 I672K probably benign Het
Foxk2 C A 11: 121,260,387 A86E probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gda A G 19: 21,397,505 probably null Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Golga3 A G 5: 110,187,990 probably null Het
Greb1 T C 12: 16,699,532 S1098G probably damaging Het
Hook3 C A 8: 26,070,197 L333F probably damaging Het
Ikbkap T A 4: 56,779,636 probably null Het
Il6 C T 5: 30,013,504 Q33* probably null Het
Iqgap1 T C 7: 80,751,953 E468G probably benign Het
Iqgap1 A G 7: 80,759,903 I228T possibly damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Kcnj10 A T 1: 172,369,888 Y323F possibly damaging Het
Klk1b5 T C 7: 44,219,898 probably null Het
Lmo7 A G 14: 101,920,515 probably benign Het
Loxhd1 A T 18: 77,356,166 T277S possibly damaging Het
Lrp5 A T 19: 3,614,339 M796K probably benign Het
Med15 A T 16: 17,685,451 probably null Het
Mfn1 T A 3: 32,542,826 H144Q probably damaging Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nrxn2 T C 19: 6,504,914 I1141T probably damaging Het
Olah T C 2: 3,365,269 S9G probably benign Het
Olfr1054 A C 2: 86,332,528 F276C probably damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr1477 T G 19: 13,502,488 I48M probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Otog T A 7: 46,302,904 C2591S probably damaging Het
Pdgfrb G T 18: 61,072,756 V605F probably damaging Het
Pik3cb T A 9: 99,101,244 K104* probably null Het
Plb1 T A 5: 32,314,089 I580N probably damaging Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Plekha7 T A 7: 116,175,767 Y213F probably damaging Het
Plin5 T C 17: 56,116,836 D33G probably benign Het
Pnpla2 C A 7: 141,459,219 Q371K probably damaging Het
Ppm1n A G 7: 19,278,185 Y348H probably damaging Het
Ppp2r1b T A 9: 50,866,554 D266E probably damaging Het
Prss23 A G 7: 89,509,911 S317P probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Pum1 G T 4: 130,751,491 A571S probably damaging Het
Rexo1 G T 10: 80,544,109 C13* probably null Het
Rhpn1 A T 15: 75,704,394 M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripk2 A G 4: 16,132,775 probably null Het
Rps6kc1 T C 1: 190,798,723 Y937C probably damaging Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Ryr2 A G 13: 11,577,873 I4665T possibly damaging Het
Sbno1 C A 5: 124,378,543 V1256F probably benign Het
Senp5 T C 16: 31,968,874 I644V probably damaging Het
Serpinb9e T A 13: 33,252,978 F94I probably damaging Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Sned1 T A 1: 93,274,657 D674E probably benign Het
Sorl1 T C 9: 41,984,492 H1789R probably benign Het
Sp2 T C 11: 96,962,008 D30G possibly damaging Het
Stk33 T A 7: 109,341,320 N61I probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tnfrsf21 A G 17: 43,087,872 D623G probably damaging Het
Trib2 A G 12: 15,793,829 F271L probably damaging Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yeats2 T A 16: 20,154,166 D23E probably damaging Het
Zan T A 5: 137,436,400 I2214F unknown Het
Zbtb40 T C 4: 136,991,635 D917G probably damaging Het
Zcchc2 C A 1: 106,021,723 probably null Het
Zdhhc23 G T 16: 43,973,919 Q131K probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp532 A G 18: 65,624,927 T644A possibly damaging Het
Other mutations in Tbcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Tbcd APN 11 121575321 missense probably damaging 0.96
IGL00795:Tbcd APN 11 121616932 missense probably benign
IGL00802:Tbcd APN 11 121608610 missense possibly damaging 0.55
IGL01286:Tbcd APN 11 121493893 critical splice donor site probably null
IGL01325:Tbcd APN 11 121540993 missense probably damaging 0.99
IGL01348:Tbcd APN 11 121497076 missense probably benign
IGL01432:Tbcd APN 11 121475680 splice site probably benign
IGL01577:Tbcd APN 11 121497012 missense probably damaging 1.00
IGL01660:Tbcd APN 11 121605327 missense probably benign 0.01
IGL01865:Tbcd APN 11 121590380 missense possibly damaging 0.81
IGL02260:Tbcd APN 11 121603278 missense probably damaging 1.00
IGL02492:Tbcd APN 11 121497134 missense probably benign 0.06
IGL02620:Tbcd APN 11 121461255 missense probably damaging 1.00
IGL02950:Tbcd APN 11 121603709 missense probably damaging 0.99
R6859_Tbcd_818 UTSW 11 121497111 missense possibly damaging 0.81
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0077:Tbcd UTSW 11 121594274 missense probably benign 0.00
R0349:Tbcd UTSW 11 121602983 splice site probably null
R0865:Tbcd UTSW 11 121602989 missense possibly damaging 0.88
R1203:Tbcd UTSW 11 121475625 missense probably benign 0.00
R1221:Tbcd UTSW 11 121497083 missense probably benign 0.00
R1549:Tbcd UTSW 11 121560753 missense probably benign
R1586:Tbcd UTSW 11 121497060 missense probably benign 0.13
R1671:Tbcd UTSW 11 121597294 missense probably benign 0.00
R2048:Tbcd UTSW 11 121540936 missense probably damaging 1.00
R2051:Tbcd UTSW 11 121453670 missense probably damaging 1.00
R2124:Tbcd UTSW 11 121603320 missense probably damaging 1.00
R2151:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R3120:Tbcd UTSW 11 121608648 missense probably damaging 0.97
R4108:Tbcd UTSW 11 121493811 missense probably benign 0.00
R4244:Tbcd UTSW 11 121594281 missense probably damaging 1.00
R4587:Tbcd UTSW 11 121605271 missense possibly damaging 0.75
R4684:Tbcd UTSW 11 121493771 missense probably damaging 1.00
R4837:Tbcd UTSW 11 121582785 critical splice donor site probably null
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4960:Tbcd UTSW 11 121573855 missense probably benign 0.03
R5157:Tbcd UTSW 11 121610027 missense probably benign 0.14
R5166:Tbcd UTSW 11 121609390 missense possibly damaging 0.87
R5403:Tbcd UTSW 11 121560743 missense probably damaging 0.99
R5406:Tbcd UTSW 11 121452101 missense probably benign
R5509:Tbcd UTSW 11 121602012 missense probably benign 0.00
R5767:Tbcd UTSW 11 121592692 missense probably benign 0.00
R5923:Tbcd UTSW 11 121580152 missense probably benign
R5966:Tbcd UTSW 11 121601911 intron probably benign
R6330:Tbcd UTSW 11 121497086 missense probably benign
R6539:Tbcd UTSW 11 121556987 critical splice donor site probably null
R6852:Tbcd UTSW 11 121609380 missense probably benign 0.36
R6859:Tbcd UTSW 11 121497111 missense possibly damaging 0.81
R7348:Tbcd UTSW 11 121594311 missense probably benign 0.22
R7479:Tbcd UTSW 11 121492605 critical splice donor site probably null
R7679:Tbcd UTSW 11 121603708 missense probably benign 0.01
R8121:Tbcd UTSW 11 121597143 splice site probably null
R8163:Tbcd UTSW 11 121493885 missense probably benign 0.00
R8165:Tbcd UTSW 11 121493885 missense probably benign 0.00
R8172:Tbcd UTSW 11 121493885 missense probably benign 0.00
Z1177:Tbcd UTSW 11 121590406 missense probably null 0.14
Predicted Primers PCR Primer
(F):5'- AGGGGACACGGGATTCTTTC -3'
(R):5'- AATGTGTCCCTGGAAGACCTG -3'

Sequencing Primer
(F):5'- GACCCAGATGTGTGCACTTCAC -3'
(R):5'- ACCTGGACTCTGTGGAAATAC -3'
Posted On2014-10-01