Incidental Mutation 'R0196:Slc34a1'
ID 23458
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Name solute carrier family 34 (sodium phosphate), member 1
Synonyms Na/Pi cotransporter, Npt2, NaPi-IIa, Slc17a2, renal Na+/Pi transporter
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R0196 (G1)
Quality Score 177
Status Not validated
Chromosome 13
Chromosomal Location 55398187-55415592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55412265 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 435 (I435F)
Ref Sequence ENSEMBL: ENSMUSP00000153038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054146] [ENSMUST00000057167] [ENSMUST00000224925] [ENSMUST00000225259]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054146
SMART Domains Protein: ENSMUSP00000054053
Gene: ENSMUSG00000044444

DomainStartEndE-ValueType
Pfam:Profilin 3 132 7.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057167
AA Change: I435F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490
AA Change: I435F

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 113 256 7.4e-28 PFAM
Pfam:Na_Pi_cotrans 359 549 2.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224043
Predicted Effect probably benign
Transcript: ENSMUST00000224925
Predicted Effect probably damaging
Transcript: ENSMUST00000225259
AA Change: I435F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225538
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Slc34a1 APN 13 55409071 missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55402733 missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55412128 missense probably damaging 1.00
IGL02525:Slc34a1 APN 13 55403238 splice site probably benign
IGL02555:Slc34a1 APN 13 55401168 missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55403236 splice site probably benign
IGL03173:Slc34a1 APN 13 55413276 missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55400778 missense probably benign 0.00
R0190:Slc34a1 UTSW 13 55409101 missense probably benign 0.00
R0362:Slc34a1 UTSW 13 55402898 splice site probably null
R1055:Slc34a1 UTSW 13 55403033 missense probably benign 0.26
R1243:Slc34a1 UTSW 13 55412131 missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55400711 missense probably benign
R1566:Slc34a1 UTSW 13 55412031 critical splice acceptor site probably null
R1732:Slc34a1 UTSW 13 55413420 missense probably benign
R1901:Slc34a1 UTSW 13 55401150 nonsense probably null
R2423:Slc34a1 UTSW 13 55409052 missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55403329 missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55413170 missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55402661 splice site probably benign
R4553:Slc34a1 UTSW 13 55412061 splice site probably null
R4735:Slc34a1 UTSW 13 55413584 missense probably benign 0.13
R5177:Slc34a1 UTSW 13 55401162 missense probably damaging 0.99
R5345:Slc34a1 UTSW 13 55400518 missense probably benign
R5363:Slc34a1 UTSW 13 55403268 missense probably benign 0.16
R5363:Slc34a1 UTSW 13 55412290 missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55409085 missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55401272 critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55402688 missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55413465 missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55412071 missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55402682 missense probably benign 0.15
R7158:Slc34a1 UTSW 13 55401231 missense probably damaging 0.99
R7384:Slc34a1 UTSW 13 55402934 missense probably benign 0.00
R7694:Slc34a1 UTSW 13 55413408 missense probably benign 0.22
R8977:Slc34a1 UTSW 13 55409002 missense probably benign 0.01
X0022:Slc34a1 UTSW 13 55403015 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGCCAGCTTACTGGGGATTTG -3'
(R):5'- TGACAGCACACTGCCTGACTTG -3'

Sequencing Primer
(F):5'- GTGCCAGCATGACCTTTG -3'
(R):5'- GCAGTGATTCACTATTAGACACC -3'
Posted On 2013-04-16