Incidental Mutation 'R2154:Yme1l1'
Institutional Source Beutler Lab
Gene Symbol Yme1l1
Ensembl Gene ENSMUSG00000026775
Gene NameYME1-like 1 (S. cerevisiae)
SynonymsATP-dependent metalloprotease FtsH1, Ftsh
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosomal Location23156369-23199260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23162508 bp
Amino Acid Change Leucine to Proline at position 58 (L58P)
Ref Sequence ENSEMBL: ENSMUSP00000028117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028117]
Predicted Effect probably damaging
Transcript: ENSMUST00000028117
AA Change: L58P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028117
Gene: ENSMUSG00000026775
AA Change: L58P

AAA 313 450 4.77e-23 SMART
Pfam:Peptidase_M41 508 706 5.8e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149240
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null embryos die prior to E13.5, and show a developmental delay from E8.5 to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Yme1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Yme1l1 APN 2 23192500 missense probably benign 0.00
IGL01764:Yme1l1 APN 2 23162544 missense probably benign 0.00
IGL03289:Yme1l1 APN 2 23160268 missense probably benign
R0043:Yme1l1 UTSW 2 23187803 missense probably damaging 0.97
R0540:Yme1l1 UTSW 2 23192515 missense possibly damaging 0.68
R0583:Yme1l1 UTSW 2 23186250 missense probably damaging 1.00
R0661:Yme1l1 UTSW 2 23191042 missense probably damaging 0.96
R0673:Yme1l1 UTSW 2 23168288 missense probably benign 0.03
R2241:Yme1l1 UTSW 2 23196900 nonsense probably null
R2270:Yme1l1 UTSW 2 23175220 missense possibly damaging 0.53
R2345:Yme1l1 UTSW 2 23194786 missense probably damaging 1.00
R3837:Yme1l1 UTSW 2 23191080 missense possibly damaging 0.69
R4344:Yme1l1 UTSW 2 23173061 missense probably benign 0.02
R4368:Yme1l1 UTSW 2 23160211 missense possibly damaging 0.81
R4412:Yme1l1 UTSW 2 23175187 missense probably damaging 1.00
R4470:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4472:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4934:Yme1l1 UTSW 2 23168321 nonsense probably null
R5033:Yme1l1 UTSW 2 23194747 missense probably damaging 1.00
R5388:Yme1l1 UTSW 2 23162557 missense probably benign 0.01
R5389:Yme1l1 UTSW 2 23193234 missense probably damaging 1.00
R5943:Yme1l1 UTSW 2 23168330 missense probably damaging 0.96
R5947:Yme1l1 UTSW 2 23195306 intron probably benign
R6243:Yme1l1 UTSW 2 23193172 missense probably benign 0.00
R6724:Yme1l1 UTSW 2 23194762 missense probably damaging 1.00
R6891:Yme1l1 UTSW 2 23195389 missense probably damaging 0.99
R7016:Yme1l1 UTSW 2 23186355 splice site probably null
R7565:Yme1l1 UTSW 2 23160220 missense possibly damaging 0.88
R7589:Yme1l1 UTSW 2 23160262 missense probably benign 0.01
R7751:Yme1l1 UTSW 2 23187844 critical splice donor site probably null
R7871:Yme1l1 UTSW 2 23181065 missense probably damaging 1.00
R7909:Yme1l1 UTSW 2 23194757 missense probably benign 0.00
R8203:Yme1l1 UTSW 2 23164526 missense probably benign 0.00
R8329:Yme1l1 UTSW 2 23164585 nonsense probably null
Z1176:Yme1l1 UTSW 2 23162517 missense probably damaging 0.96
Z1176:Yme1l1 UTSW 2 23193184 missense probably damaging 0.98
Z1177:Yme1l1 UTSW 2 23186877 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01