Incidental Mutation 'R2154:Zfhx4'
Institutional Source Beutler Lab
Gene Symbol Zfhx4
Ensembl Gene ENSMUSG00000025255
Gene Namezinc finger homeodomain 4
SynonymsZfh4, C130041O22Rik, Zfh-4
MMRRC Submission 040157-MU
Accession Numbers

Genbank: NM_030708; MGI: 2137668

Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosomal Location5218526-5415857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5401741 bp
Amino Acid Change Threonine to Alanine at position 2320 (T2320A)
Ref Sequence ENSEMBL: ENSMUSP00000135289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026284
AA Change: T2320A

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: T2320A

ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175866
AA Change: T2345A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: T2345A

ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 902 923 2.44e2 SMART
ZnF_U1 938 972 2.88e0 SMART
ZnF_C2H2 941 965 1.23e0 SMART
ZnF_C2H2 997 1019 7.05e-1 SMART
ZnF_U1 1042 1076 3.73e0 SMART
ZnF_C2H2 1045 1069 4.98e-1 SMART
ZnF_C2H2 1213 1236 1.1e-2 SMART
ZnF_C2H2 1242 1265 4.94e0 SMART
ZnF_C2H2 1393 1415 7.67e-2 SMART
ZnF_C2H2 1421 1444 1.33e-1 SMART
ZnF_U1 1534 1568 7.4e-1 SMART
ZnF_C2H2 1537 1561 8.22e-2 SMART
ZnF_U1 1586 1620 3.73e0 SMART
ZnF_C2H2 1589 1613 1.16e-1 SMART
low complexity region 1689 1717 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1787 1833 N/A INTRINSIC
ZnF_C2H2 1941 1964 3.07e-1 SMART
low complexity region 1989 2015 N/A INTRINSIC
low complexity region 2033 2057 N/A INTRINSIC
low complexity region 2080 2097 N/A INTRINSIC
HOX 2125 2187 4.23e-16 SMART
HOX 2222 2284 5.62e-21 SMART
ZnF_C2H2 2308 2328 1.13e1 SMART
low complexity region 2389 2401 N/A INTRINSIC
low complexity region 2433 2450 N/A INTRINSIC
low complexity region 2474 2485 N/A INTRINSIC
ZnF_C2H2 2486 2508 2.17e-1 SMART
HOX 2598 2660 3.18e-20 SMART
ZnF_C2H2 2668 2691 6.67e-2 SMART
low complexity region 2899 2911 N/A INTRINSIC
HOX 2921 2983 4.54e-16 SMART
ZnF_U1 2996 3030 6.59e-1 SMART
ZnF_C2H2 2999 3023 1.36e1 SMART
low complexity region 3091 3103 N/A INTRINSIC
low complexity region 3131 3144 N/A INTRINSIC
low complexity region 3188 3211 N/A INTRINSIC
coiled coil region 3304 3333 N/A INTRINSIC
ZnF_C2H2 3393 3413 1.12e2 SMART
ZnF_U1 3434 3468 6.16e-2 SMART
ZnF_C2H2 3437 3461 6.57e0 SMART
low complexity region 3486 3504 N/A INTRINSIC
low complexity region 3530 3552 N/A INTRINSIC
low complexity region 3561 3572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176383
AA Change: T2320A

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: T2320A

ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Zfhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfhx4 APN 3 5242341 missense probably damaging 1.00
IGL00915:Zfhx4 APN 3 5245523 missense probably damaging 0.99
IGL01145:Zfhx4 APN 3 5245347 missense probably damaging 1.00
IGL01302:Zfhx4 APN 3 5243568 missense probably damaging 1.00
IGL01314:Zfhx4 APN 3 5413094 missense probably damaging 0.98
IGL01321:Zfhx4 APN 3 5242328 missense probably benign 0.01
IGL01328:Zfhx4 APN 3 5244284 missense probably damaging 1.00
IGL01333:Zfhx4 APN 3 5399327 missense probably damaging 1.00
IGL01351:Zfhx4 APN 3 5401136 missense probably damaging 1.00
IGL01524:Zfhx4 APN 3 5243976 missense probably damaging 1.00
IGL01549:Zfhx4 APN 3 5399462 missense probably damaging 1.00
IGL01715:Zfhx4 APN 3 5242045 missense probably benign 0.00
IGL01736:Zfhx4 APN 3 5244092 missense possibly damaging 0.85
IGL01904:Zfhx4 APN 3 5412709 missense probably damaging 1.00
IGL02298:Zfhx4 APN 3 5244304 splice site probably null
IGL02342:Zfhx4 APN 3 5402374 missense probably benign 0.14
IGL02465:Zfhx4 APN 3 5399603 missense possibly damaging 0.48
IGL02481:Zfhx4 APN 3 5411843 missense probably damaging 0.99
IGL02511:Zfhx4 APN 3 5399183 missense probably damaging 1.00
IGL02571:Zfhx4 APN 3 5329523 missense probably damaging 1.00
IGL02685:Zfhx4 APN 3 5412153 missense probably damaging 1.00
IGL02721:Zfhx4 APN 3 5243307 missense possibly damaging 0.76
IGL02806:Zfhx4 APN 3 5390408 missense probably benign 0.00
IGL03140:Zfhx4 APN 3 5242525 missense probably damaging 1.00
IGL03185:Zfhx4 APN 3 5403914 missense probably benign 0.05
IGL03209:Zfhx4 APN 3 5401171 missense probably damaging 1.00
IGL03292:Zfhx4 APN 3 5411780 nonsense probably null
IGL03302:Zfhx4 APN 3 5403713 missense possibly damaging 0.88
IGL03303:Zfhx4 APN 3 5403350 missense probably damaging 1.00
IGL03341:Zfhx4 APN 3 5411850 missense probably damaging 0.98
3-1:Zfhx4 UTSW 3 5403385 missense probably benign 0.14
B5639:Zfhx4 UTSW 3 5403175 missense probably damaging 0.99
IGL02796:Zfhx4 UTSW 3 5399539 missense probably damaging 1.00
IGL03047:Zfhx4 UTSW 3 5243733 missense probably damaging 0.99
P0025:Zfhx4 UTSW 3 5399588 missense probably benign 0.04
PIT4377001:Zfhx4 UTSW 3 5242742 missense probably damaging 0.98
R0090:Zfhx4 UTSW 3 5243625 missense probably damaging 1.00
R0107:Zfhx4 UTSW 3 5398982 missense probably damaging 1.00
R0401:Zfhx4 UTSW 3 5401161 missense possibly damaging 0.87
R0465:Zfhx4 UTSW 3 5245656 splice site probably benign
R0506:Zfhx4 UTSW 3 5402735 missense probably damaging 1.00
R0507:Zfhx4 UTSW 3 5400988 nonsense probably null
R0550:Zfhx4 UTSW 3 5400494 missense probably damaging 0.99
R0576:Zfhx4 UTSW 3 5402101 missense probably damaging 1.00
R0590:Zfhx4 UTSW 3 5402633 missense probably damaging 1.00
R0697:Zfhx4 UTSW 3 5401733 missense probably damaging 0.99
R0727:Zfhx4 UTSW 3 5401073 missense probably damaging 0.98
R0762:Zfhx4 UTSW 3 5403820 missense probably damaging 1.00
R0815:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0863:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0866:Zfhx4 UTSW 3 5412212 missense possibly damaging 0.58
R1109:Zfhx4 UTSW 3 5399870 missense possibly damaging 0.59
R1177:Zfhx4 UTSW 3 5400831 small deletion probably benign
R1338:Zfhx4 UTSW 3 5396961 missense possibly damaging 0.86
R1388:Zfhx4 UTSW 3 5401387 missense probably damaging 1.00
R1434:Zfhx4 UTSW 3 5241859 missense probably benign 0.00
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1552:Zfhx4 UTSW 3 5403110 missense probably damaging 1.00
R1589:Zfhx4 UTSW 3 5241729 missense probably damaging 1.00
R1633:Zfhx4 UTSW 3 5400413 missense probably damaging 1.00
R1656:Zfhx4 UTSW 3 5413016 missense probably damaging 1.00
R1717:Zfhx4 UTSW 3 5403104 missense probably benign 0.20
R1739:Zfhx4 UTSW 3 5401730 missense probably damaging 1.00
R1760:Zfhx4 UTSW 3 5382616 missense probably benign
R1842:Zfhx4 UTSW 3 5401498 missense probably damaging 1.00
R1867:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R1868:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R2064:Zfhx4 UTSW 3 5398927 missense probably damaging 1.00
R2083:Zfhx4 UTSW 3 5403163 missense possibly damaging 0.58
R2165:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2181:Zfhx4 UTSW 3 5403332 missense probably damaging 1.00
R2201:Zfhx4 UTSW 3 5242289 missense probably damaging 1.00
R2209:Zfhx4 UTSW 3 5396918 missense probably damaging 1.00
R2303:Zfhx4 UTSW 3 5397060 missense probably damaging 0.99
R2327:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2420:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2422:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2516:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2518:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2519:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2520:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2566:Zfhx4 UTSW 3 5245143 missense probably damaging 0.98
R2922:Zfhx4 UTSW 3 5403664 missense probably damaging 1.00
R3000:Zfhx4 UTSW 3 5403654 missense probably damaging 1.00
R3103:Zfhx4 UTSW 3 5399326 missense probably damaging 1.00
R3409:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3414:Zfhx4 UTSW 3 5403823 missense probably damaging 1.00
R3746:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3747:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3748:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3749:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3750:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3763:Zfhx4 UTSW 3 5403344 missense probably damaging 1.00
R3826:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3827:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3830:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3877:Zfhx4 UTSW 3 5400785 missense probably benign
R3919:Zfhx4 UTSW 3 5399115 missense possibly damaging 0.48
R3922:Zfhx4 UTSW 3 5400647 missense probably damaging 1.00
R3927:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3965:Zfhx4 UTSW 3 5403847 missense probably damaging 1.00
R4004:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R4049:Zfhx4 UTSW 3 5398859 missense probably damaging 1.00
R4073:Zfhx4 UTSW 3 5399324 missense probably damaging 1.00
R4134:Zfhx4 UTSW 3 5243627 missense probably damaging 1.00
R4401:Zfhx4 UTSW 3 5403345 nonsense probably null
R4439:Zfhx4 UTSW 3 5214815 unclassified probably benign
R4497:Zfhx4 UTSW 3 5399620 missense possibly damaging 0.88
R4518:Zfhx4 UTSW 3 5412518 missense probably damaging 1.00
R4569:Zfhx4 UTSW 3 5401834 missense probably benign 0.00
R4612:Zfhx4 UTSW 3 5397063 missense probably damaging 1.00
R4616:Zfhx4 UTSW 3 5413067 missense possibly damaging 0.66
R4626:Zfhx4 UTSW 3 5402639 missense probably damaging 1.00
R4628:Zfhx4 UTSW 3 5403476 missense probably damaging 1.00
R4637:Zfhx4 UTSW 3 5403404 missense probably damaging 1.00
R4647:Zfhx4 UTSW 3 5399281 missense probably damaging 0.99
R4708:Zfhx4 UTSW 3 5245503 splice site probably null
R4729:Zfhx4 UTSW 3 5399497 missense probably damaging 1.00
R4732:Zfhx4 UTSW 3 5214807 unclassified probably benign
R4757:Zfhx4 UTSW 3 5400062 missense possibly damaging 0.85
R4765:Zfhx4 UTSW 3 5400152 missense probably benign
R4819:Zfhx4 UTSW 3 5403914 missense probably benign 0.05
R4937:Zfhx4 UTSW 3 5242011 missense probably damaging 1.00
R4980:Zfhx4 UTSW 3 5398979 missense possibly damaging 0.47
R5124:Zfhx4 UTSW 3 5242047 missense probably damaging 1.00
R5214:Zfhx4 UTSW 3 5403641 missense probably damaging 1.00
R5361:Zfhx4 UTSW 3 5399207 missense probably damaging 0.99
R5375:Zfhx4 UTSW 3 5412425 missense probably damaging 0.99
R5485:Zfhx4 UTSW 3 5243007 missense probably damaging 1.00
R5588:Zfhx4 UTSW 3 5403138 missense probably damaging 1.00
R5609:Zfhx4 UTSW 3 5403619 missense probably damaging 1.00
R5726:Zfhx4 UTSW 3 5403321 missense probably benign 0.02
R5758:Zfhx4 UTSW 3 5402620 missense probably damaging 1.00
R5865:Zfhx4 UTSW 3 5402659 missense probably damaging 1.00
R5938:Zfhx4 UTSW 3 5402138 missense probably damaging 0.99
R5952:Zfhx4 UTSW 3 5396970 missense probably damaging 0.99
R6043:Zfhx4 UTSW 3 5403427 missense probably benign 0.00
R6045:Zfhx4 UTSW 3 5396959 missense probably damaging 1.00
R6125:Zfhx4 UTSW 3 5398811 missense possibly damaging 0.68
R6354:Zfhx4 UTSW 3 5401951 missense probably benign
R6374:Zfhx4 UTSW 3 5244035 missense probably damaging 1.00
R6378:Zfhx4 UTSW 3 5243350 missense probably benign 0.07
R6380:Zfhx4 UTSW 3 5413110 missense probably damaging 0.99
R6413:Zfhx4 UTSW 3 5243145 missense probably damaging 1.00
R6449:Zfhx4 UTSW 3 5242428 missense probably damaging 1.00
R6539:Zfhx4 UTSW 3 5244108 missense probably damaging 0.99
R6714:Zfhx4 UTSW 3 5241837 missense probably damaging 1.00
R6933:Zfhx4 UTSW 3 5412987 missense probably damaging 0.99
R6982:Zfhx4 UTSW 3 5403830 missense probably damaging 1.00
R7104:Zfhx4 UTSW 3 5402489 missense probably damaging 0.97
R7127:Zfhx4 UTSW 3 5413044 missense probably damaging 0.99
R7138:Zfhx4 UTSW 3 5412047 missense possibly damaging 0.69
R7161:Zfhx4 UTSW 3 5244083 missense possibly damaging 0.65
R7213:Zfhx4 UTSW 3 5396644 missense probably benign
R7483:Zfhx4 UTSW 3 5412177 missense probably damaging 0.98
R7514:Zfhx4 UTSW 3 5242207 missense possibly damaging 0.91
R7544:Zfhx4 UTSW 3 5412815 missense probably damaging 0.98
R7565:Zfhx4 UTSW 3 5390366 missense probably benign 0.04
R7611:Zfhx4 UTSW 3 5403771 missense probably damaging 1.00
R7640:Zfhx4 UTSW 3 5412480 missense probably benign 0.19
R7649:Zfhx4 UTSW 3 5242110 missense probably damaging 1.00
R7689:Zfhx4 UTSW 3 5411886 missense probably benign 0.05
R7711:Zfhx4 UTSW 3 5396956 missense probably damaging 0.98
R7895:Zfhx4 UTSW 3 5242199 missense probably benign 0.00
R7920:Zfhx4 UTSW 3 5400455 missense possibly damaging 0.62
R7972:Zfhx4 UTSW 3 5412473 missense probably benign 0.02
R7993:Zfhx4 UTSW 3 5412987 missense probably damaging 1.00
R8133:Zfhx4 UTSW 3 5400494 missense probably damaging 0.99
R8158:Zfhx4 UTSW 3 5398950 nonsense probably null
R8272:Zfhx4 UTSW 3 5243867 missense probably damaging 0.99
R8285:Zfhx4 UTSW 3 5401856 missense probably benign 0.17
R8321:Zfhx4 UTSW 3 5401127 missense probably damaging 1.00
R8381:Zfhx4 UTSW 3 5382616 missense probably benign 0.00
R8434:Zfhx4 UTSW 3 5398858 missense probably damaging 0.99
R8515:Zfhx4 UTSW 3 5399474 missense probably benign 0.00
RF019:Zfhx4 UTSW 3 5403267 missense probably benign 0.08
X0025:Zfhx4 UTSW 3 5411836 missense probably damaging 0.99
X0026:Zfhx4 UTSW 3 5412338 missense probably benign 0.00
X0028:Zfhx4 UTSW 3 5402414 missense probably benign 0.13
X0028:Zfhx4 UTSW 3 5403267 missense probably damaging 1.00
X0054:Zfhx4 UTSW 3 5399710 nonsense probably null
Z1177:Zfhx4 UTSW 3 5242446 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01