Incidental Mutation 'R2154:Creb3l4'
ID234597
Institutional Source Beutler Lab
Gene Symbol Creb3l4
Ensembl Gene ENSMUSG00000027938
Gene NamecAMP responsive element binding protein 3-like 4
SynonymsTisp40alpha, JAL, Tisp40beta, Tisp40, 1700012K17Rik, 5330432F22Rik, mJAL, ATCE1
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.699) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90237500-90243512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90238485 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 246 (N246K)
Ref Sequence ENSEMBL: ENSMUSP00000102992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029546] [ENSMUST00000029547] [ENSMUST00000029547] [ENSMUST00000107369] [ENSMUST00000107369] [ENSMUST00000119304]
Predicted Effect probably benign
Transcript: ENSMUST00000029546
SMART Domains Protein: ENSMUSP00000029546
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:JTB 37 143 5.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000029547
AA Change: N246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029547
Gene: ENSMUSG00000027938
AA Change: N246K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000029547
AA Change: N246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029547
Gene: ENSMUSG00000027938
AA Change: N246K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107369
AA Change: N246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102992
Gene: ENSMUSG00000027938
AA Change: N246K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107369
AA Change: N246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102992
Gene: ENSMUSG00000027938
AA Change: N246K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119304
SMART Domains Protein: ENSMUSP00000113763
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:JTB 30 95 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157045
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a CREB (cyclic AMP-responsive element-binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein may play a role in adiposity and male germ cell development. Homozygous knockout mice for this gene show increased adipogenesis, elevated testicular germ cell apoptosis and defects in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display oligozoospermia but have normal fertility and sperm morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Creb3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Creb3l4 APN 3 90241987 missense possibly damaging 0.95
IGL01015:Creb3l4 APN 3 90242831 start codon destroyed probably null
IGL01092:Creb3l4 APN 3 90237738 missense probably damaging 1.00
IGL02172:Creb3l4 APN 3 90242775 missense probably benign 0.21
IGL02291:Creb3l4 APN 3 90241983 missense probably benign 0.03
R1344:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1418:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1836:Creb3l4 UTSW 3 90238903 missense probably benign 0.26
R2877:Creb3l4 UTSW 3 90242308 missense probably damaging 0.99
R4923:Creb3l4 UTSW 3 90242214 missense probably benign 0.00
R6024:Creb3l4 UTSW 3 90238699 missense probably damaging 1.00
R6683:Creb3l4 UTSW 3 90237805 missense probably benign 0.08
R7567:Creb3l4 UTSW 3 90242422 missense probably benign 0.00
Z1088:Creb3l4 UTSW 3 90237751 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTGATGGTACCAGAACACAG -3'
(R):5'- AATCCGCAACAAGCAGTCGG -3'

Sequencing Primer
(F):5'- AACACAGGTGCTGGTCTG -3'
(R):5'- TACTTAGATGGGCTGGAGAGC -3'
Posted On2014-10-01