Incidental Mutation 'R0196:Nisch'
List |< first << previous [record 47 of 77] next >> last >|
ID23460
Institutional Source Beutler Lab
Gene Symbol Nisch
Ensembl Gene ENSMUSG00000021910
Gene Namenischarin
Synonyms1200007D05Rik, 3202002H23Rik
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0196 (G1)
Quality Score202
Status Not validated
Chromosome14
Chromosomal Location31170930-31216946 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 31203394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000164989] [ENSMUST00000165981] [ENSMUST00000169169] [ENSMUST00000170268] [ENSMUST00000171735] [ENSMUST00000172142]
Predicted Effect unknown
Transcript: ENSMUST00000022469
AA Change: K66E
SMART Domains Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910
AA Change: K66E

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
PDB:4PQ8|A 287 420 9e-8 PDB
SCOP:d1h6ta2 291 421 6e-29 SMART
Blast:LRR 311 332 5e-6 BLAST
Blast:LRR 333 355 6e-6 BLAST
Blast:LRR 378 403 5e-7 BLAST
Blast:LRR 403 429 6e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
coiled coil region 625 650 N/A INTRINSIC
low complexity region 662 695 N/A INTRINSIC
low complexity region 1038 1069 N/A INTRINSIC
low complexity region 1081 1193 N/A INTRINSIC
low complexity region 1491 1509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164617
Predicted Effect unknown
Transcript: ENSMUST00000164989
AA Change: K66E
SMART Domains Protein: ENSMUSP00000126982
Gene: ENSMUSG00000021910
AA Change: K66E

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_4 289 332 3.2e-8 PFAM
Pfam:LRR_1 290 311 2.9e-3 PFAM
Pfam:LRR_1 313 332 4.2e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165981
AA Change: K66E
SMART Domains Protein: ENSMUSP00000130210
Gene: ENSMUSG00000021910
AA Change: K66E

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_7 289 305 7.4e-2 PFAM
Pfam:LRR_6 289 309 3.8e-2 PFAM
Pfam:LRR_4 289 333 5.9e-8 PFAM
Pfam:LRR_8 289 346 6.8e-10 PFAM
Pfam:LRR_1 290 311 4.4e-3 PFAM
Pfam:LRR_8 312 369 7.3e-9 PFAM
Pfam:LRR_1 313 333 1.8e-2 PFAM
Pfam:LRR_4 329 377 2.3e-8 PFAM
Pfam:LRR_6 333 354 2e-3 PFAM
Pfam:LRR_7 334 350 1.9e-1 PFAM
Pfam:LRR_1 335 354 1.2e-2 PFAM
Blast:LRR 378 403 1e-6 BLAST
Blast:LRR 403 429 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168451
SMART Domains Protein: ENSMUSP00000132912
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Pfam:PX 4 53 5.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169149
SMART Domains Protein: ENSMUSP00000131623
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Blast:PX 2 27 1e-10 BLAST
PDB:3P0C|B 2 33 7e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169169
SMART Domains Protein: ENSMUSP00000131991
Gene: ENSMUSG00000091898

DomainStartEndE-ValueType
EFh 19 48 1.08e2 SMART
EFh 56 84 2.39e-8 SMART
EFh 96 124 2.7e-7 SMART
EFh 132 160 4.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170268
SMART Domains Protein: ENSMUSP00000128765
Gene: ENSMUSG00000091898

DomainStartEndE-ValueType
EFh 19 48 1.08e2 SMART
EFh 56 84 2.39e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171735
AA Change: K66E
SMART Domains Protein: ENSMUSP00000127132
Gene: ENSMUSG00000021910
AA Change: K66E

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172142
AA Change: K66E
SMART Domains Protein: ENSMUSP00000132413
Gene: ENSMUSG00000021910
AA Change: K66E

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_7 289 305 8.2e-2 PFAM
Pfam:LRR_6 289 309 4.2e-2 PFAM
Pfam:LRR_4 289 333 6.6e-8 PFAM
Pfam:LRR_8 289 346 7.6e-10 PFAM
Pfam:LRR_1 290 311 4.9e-3 PFAM
Pfam:LRR_8 312 369 7.7e-9 PFAM
Pfam:LRR_1 313 333 2e-2 PFAM
Pfam:LRR_4 329 377 2.7e-8 PFAM
Pfam:LRR_6 333 354 2.2e-3 PFAM
Pfam:LRR_7 334 350 2.1e-1 PFAM
Pfam:LRR_1 335 354 1.3e-2 PFAM
Blast:LRR 378 403 1e-6 BLAST
Blast:LRR 403 429 1e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or hypomorphic allele exhibit hearing loss associated with increased susceptibility to otitis media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Nisch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Nisch APN 14 31176639 unclassified probably benign
IGL01934:Nisch APN 14 31176739 unclassified probably benign
IGL02201:Nisch APN 14 31187094 unclassified probably benign
IGL02964:Nisch APN 14 31180812 unclassified probably benign
IGL03340:Nisch APN 14 31173144 missense probably damaging 0.98
R0092:Nisch UTSW 14 31191453 unclassified probably benign
R0119:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0299:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0452:Nisch UTSW 14 31177464 utr 3 prime probably benign
R1529:Nisch UTSW 14 31180938 unclassified probably benign
R1643:Nisch UTSW 14 31173168 missense probably damaging 1.00
R1656:Nisch UTSW 14 31177271 unclassified probably benign
R1663:Nisch UTSW 14 31191521 unclassified probably benign
R1676:Nisch UTSW 14 31180902 unclassified probably benign
R1750:Nisch UTSW 14 31174882 unclassified probably benign
R1799:Nisch UTSW 14 31177271 unclassified probably benign
R1824:Nisch UTSW 14 31176432 unclassified probably benign
R1876:Nisch UTSW 14 31173637 missense probably damaging 1.00
R2107:Nisch UTSW 14 31172140 missense probably damaging 0.99
R2117:Nisch UTSW 14 31177285 unclassified probably benign
R2276:Nisch UTSW 14 31176846 unclassified probably benign
R2402:Nisch UTSW 14 31185014 intron probably benign
R3703:Nisch UTSW 14 31176745 unclassified probably benign
R3704:Nisch UTSW 14 31176745 unclassified probably benign
R3705:Nisch UTSW 14 31176745 unclassified probably benign
R3897:Nisch UTSW 14 31191000 unclassified probably benign
R4024:Nisch UTSW 14 31176819 unclassified probably benign
R4412:Nisch UTSW 14 31186658 intron probably benign
R4752:Nisch UTSW 14 31192588 missense probably damaging 1.00
R4832:Nisch UTSW 14 31177630 utr 3 prime probably benign
R5009:Nisch UTSW 14 31187229 unclassified probably benign
R5043:Nisch UTSW 14 31176465 unclassified probably benign
R5062:Nisch UTSW 14 31172440 missense probably damaging 0.99
R5254:Nisch UTSW 14 31206567 splice site probably null
R5754:Nisch UTSW 14 31191416 unclassified probably benign
R5906:Nisch UTSW 14 31172028 intron probably null
R5930:Nisch UTSW 14 31173145 missense probably benign 0.11
R6246:Nisch UTSW 14 31172559 missense probably damaging 1.00
R6258:Nisch UTSW 14 31177128 unclassified probably benign
R6260:Nisch UTSW 14 31177128 unclassified probably benign
R6327:Nisch UTSW 14 31171487 utr 3 prime probably benign
R6671:Nisch UTSW 14 31204463 unclassified probably benign
R6874:Nisch UTSW 14 31176684 unclassified probably benign
R6887:Nisch UTSW 14 31185344 unclassified probably benign
R7273:Nisch UTSW 14 31174407 missense unknown
R7401:Nisch UTSW 14 31206580 missense probably benign 0.18
R7423:Nisch UTSW 14 31171701 missense probably benign 0.09
R7822:Nisch UTSW 14 31174651 unclassified probably benign
R7870:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7887:Nisch UTSW 14 31176695 nonsense probably null
R7953:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7970:Nisch UTSW 14 31176695 nonsense probably null
X0027:Nisch UTSW 14 31187084 unclassified probably benign
Z1177:Nisch UTSW 14 31177438 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTCTGTGTCTCCTCAAAGCCAAG -3'
(R):5'- TGCATTAGTTGGAGCACTAATCCCG -3'

Sequencing Primer
(F):5'- CCCCAAAGGAACTTACATAGAGGTG -3'
(R):5'- ACTAATCCCGGCCCTGC -3'
Posted On2013-04-16