Incidental Mutation 'R2154:Zan'
Institutional Source Beutler Lab
Gene Symbol Zan
Ensembl Gene ENSMUSG00000079173
Gene Namezonadhesin
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosomal Location137378637-137477064 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 137414249 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000117564] [ENSMUST00000164178]
Predicted Effect unknown
Transcript: ENSMUST00000117564
AA Change: P3267S
SMART Domains Protein: ENSMUSP00000114068
Gene: ENSMUSG00000079173
AA Change: P3267S

signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 4.5e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 3e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 1.9e-12 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150470
SMART Domains Protein: ENSMUSP00000114562
Gene: ENSMUSG00000079173

Pfam:TIL 1 54 1.9e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164178
AA Change: P3267S
SMART Domains Protein: ENSMUSP00000132895
Gene: ENSMUSG00000079173
AA Change: P3267S

signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 2.3e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 6e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 7.2e-13 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the species specificity of sperm adhesion to the egg zona pellucida. The encoded protein is located in the acrosome and may be involved in signaling or gamete recognition. An allelic polymorphism in this gene results in both functional and frameshifted alleles; the reference genome represents the functional allele. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Sperm from mice homozygous for a knock-out allele exhibit decreased species-specific zona pellucida adhesion without alteration in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Zan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zan APN 5 137387820 critical splice donor site probably null
IGL00158:Zan APN 5 137454257 missense unknown
IGL00473:Zan APN 5 137464250 missense possibly damaging 0.68
IGL00536:Zan APN 5 137446682 missense unknown
IGL00567:Zan APN 5 137416277 unclassified probably benign
IGL00820:Zan APN 5 137386364 missense unknown
IGL00850:Zan APN 5 137464113 missense unknown
IGL00906:Zan APN 5 137389360 missense unknown
IGL00920:Zan APN 5 137464524 missense unknown
IGL00964:Zan APN 5 137405941 unclassified probably benign
IGL01356:Zan APN 5 137436432 missense unknown
IGL01361:Zan APN 5 137414342 unclassified probably benign
IGL01362:Zan APN 5 137452450 missense unknown
IGL01411:Zan APN 5 137388893 missense unknown
IGL01412:Zan APN 5 137393032 missense unknown
IGL01531:Zan APN 5 137424612 missense unknown
IGL01561:Zan APN 5 137463866 missense unknown
IGL01564:Zan APN 5 137446733 missense unknown
IGL01568:Zan APN 5 137464844 missense unknown
IGL01719:Zan APN 5 137395654 missense unknown
IGL01732:Zan APN 5 137393011 missense unknown
IGL01761:Zan APN 5 137425597 missense unknown
IGL01771:Zan APN 5 137393068 missense unknown
IGL01810:Zan APN 5 137463626 missense unknown
IGL01845:Zan APN 5 137380854 unclassified probably benign
IGL01885:Zan APN 5 137464124 missense unknown
IGL01992:Zan APN 5 137424106 missense unknown
IGL02026:Zan APN 5 137405464 unclassified probably benign
IGL02065:Zan APN 5 137386960 nonsense probably null
IGL02133:Zan APN 5 137411498 missense possibly damaging 0.84
IGL02274:Zan APN 5 137421167 missense unknown
IGL02449:Zan APN 5 137389327 missense unknown
IGL02456:Zan APN 5 137446844 missense unknown
IGL02493:Zan APN 5 137435706 missense unknown
IGL02496:Zan APN 5 137464794 nonsense probably null
IGL02528:Zan APN 5 137465141 missense possibly damaging 0.83
IGL02550:Zan APN 5 137387039 missense unknown
IGL02598:Zan APN 5 137446211 missense unknown
IGL02697:Zan APN 5 137400548 missense unknown
IGL02933:Zan APN 5 137428414 missense unknown
IGL02963:Zan APN 5 137456250 missense unknown
IGL02972:Zan APN 5 137463686 missense unknown
IGL03068:Zan APN 5 137476415 missense probably damaging 1.00
IGL03104:Zan APN 5 137463500 missense unknown
IGL03110:Zan APN 5 137420016 missense unknown
IGL03156:Zan APN 5 137463939 missense unknown
IGL03302:Zan APN 5 137468390 missense possibly damaging 0.93
IGL03307:Zan APN 5 137474025 missense probably damaging 0.99
IGL03340:Zan APN 5 137427874 missense unknown
IGL03379:Zan APN 5 137464215 missense unknown
IGL03405:Zan APN 5 137424597 missense unknown
Befallen UTSW 5 137412676 unclassified probably benign
befell UTSW 5 137446037 intron probably null
PIT4283001:Zan UTSW 5 137400093 missense unknown
PIT4431001:Zan UTSW 5 137392064 missense unknown
PIT4498001:Zan UTSW 5 137417036 critical splice donor site probably null
R0027:Zan UTSW 5 137406519 unclassified probably benign
R0047:Zan UTSW 5 137403656 missense unknown
R0149:Zan UTSW 5 137396766 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0361:Zan UTSW 5 137396766 missense unknown
R0432:Zan UTSW 5 137382316 unclassified probably benign
R0436:Zan UTSW 5 137464902 missense unknown
R0446:Zan UTSW 5 137391658 missense unknown
R0457:Zan UTSW 5 137407706 unclassified probably benign
R0478:Zan UTSW 5 137400526 splice site probably benign
R0487:Zan UTSW 5 137413358 critical splice donor site probably null
R0497:Zan UTSW 5 137412676 unclassified probably benign
R0504:Zan UTSW 5 137470318 missense probably damaging 1.00
R0545:Zan UTSW 5 137396177 missense unknown
R0556:Zan UTSW 5 137454220 missense unknown
R0615:Zan UTSW 5 137468431 missense probably damaging 1.00
R0737:Zan UTSW 5 137389249 missense unknown
R0835:Zan UTSW 5 137408397 unclassified probably benign
R0863:Zan UTSW 5 137458639 missense unknown
R0971:Zan UTSW 5 137434063 missense unknown
R1327:Zan UTSW 5 137465911 splice site probably benign
R1338:Zan UTSW 5 137393651 nonsense probably null
R1413:Zan UTSW 5 137427939 missense unknown
R1446:Zan UTSW 5 137389360 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1561:Zan UTSW 5 137380838 nonsense probably null
R1569:Zan UTSW 5 137429130 missense unknown
R1575:Zan UTSW 5 137461952 missense unknown
R1618:Zan UTSW 5 137383830 missense unknown
R1634:Zan UTSW 5 137412790 unclassified probably benign
R1650:Zan UTSW 5 137394601 splice site probably benign
R1680:Zan UTSW 5 137403050 missense unknown
R1698:Zan UTSW 5 137409669 utr 3 prime probably benign
R1704:Zan UTSW 5 137434002 nonsense probably null
R1728:Zan UTSW 5 137415018 unclassified probably benign
R1729:Zan UTSW 5 137415018 unclassified probably benign
R1769:Zan UTSW 5 137464518 missense unknown
R1774:Zan UTSW 5 137419989 missense unknown
R1800:Zan UTSW 5 137386451 missense unknown
R1858:Zan UTSW 5 137405877 unclassified probably benign
R1888:Zan UTSW 5 137389328 missense unknown
R1888:Zan UTSW 5 137389328 missense unknown
R1925:Zan UTSW 5 137425642 missense unknown
R1938:Zan UTSW 5 137388939 missense unknown
R1955:Zan UTSW 5 137389283 missense unknown
R1989:Zan UTSW 5 137420006 nonsense probably null
R1997:Zan UTSW 5 137403114 nonsense probably null
R2008:Zan UTSW 5 137452450 missense unknown
R2035:Zan UTSW 5 137443947 missense unknown
R2153:Zan UTSW 5 137436400 missense unknown
R2176:Zan UTSW 5 137421848 missense unknown
R2217:Zan UTSW 5 137410306 utr 3 prime probably benign
R2218:Zan UTSW 5 137410306 utr 3 prime probably benign
R2237:Zan UTSW 5 137457837 nonsense probably null
R2239:Zan UTSW 5 137457837 nonsense probably null
R2346:Zan UTSW 5 137421867 missense unknown
R2360:Zan UTSW 5 137396126 missense unknown
R2389:Zan UTSW 5 137476380 critical splice donor site probably null
R2412:Zan UTSW 5 137414163 splice site probably null
R2426:Zan UTSW 5 137388992 missense unknown
R2435:Zan UTSW 5 137438574 missense unknown
R2509:Zan UTSW 5 137456586 missense unknown
R3416:Zan UTSW 5 137435720 missense unknown
R3691:Zan UTSW 5 137420019 missense unknown
R3853:Zan UTSW 5 137474064 missense probably damaging 1.00
R4006:Zan UTSW 5 137463939 missense unknown
R4007:Zan UTSW 5 137463939 missense unknown
R4033:Zan UTSW 5 137437860 nonsense probably null
R4059:Zan UTSW 5 137436820 missense unknown
R4109:Zan UTSW 5 137458619 missense unknown
R4194:Zan UTSW 5 137463555 missense unknown
R4226:Zan UTSW 5 137423978 missense unknown
R4457:Zan UTSW 5 137411516 missense unknown
R4544:Zan UTSW 5 137383834 missense unknown
R4546:Zan UTSW 5 137383834 missense unknown
R4642:Zan UTSW 5 137464188 missense unknown
R4708:Zan UTSW 5 137446712 missense unknown
R4773:Zan UTSW 5 137436313 splice site probably benign
R4774:Zan UTSW 5 137389019 missense unknown
R4788:Zan UTSW 5 137442113 missense unknown
R4795:Zan UTSW 5 137380850 nonsense probably null
R4796:Zan UTSW 5 137380850 nonsense probably null
R4812:Zan UTSW 5 137456285 missense unknown
R4832:Zan UTSW 5 137393161 missense unknown
R4882:Zan UTSW 5 137438448 missense unknown
R4896:Zan UTSW 5 137386456 missense unknown
R4921:Zan UTSW 5 137408370 unclassified probably benign
R4943:Zan UTSW 5 137457890 missense unknown
R4978:Zan UTSW 5 137406921 unclassified probably benign
R5013:Zan UTSW 5 137383837 missense unknown
R5024:Zan UTSW 5 137461893 nonsense probably null
R5230:Zan UTSW 5 137454078 missense unknown
R5354:Zan UTSW 5 137380788 unclassified probably benign
R5380:Zan UTSW 5 137457840 missense unknown
R5394:Zan UTSW 5 137435634 missense unknown
R5394:Zan UTSW 5 137464074 missense unknown
R5435:Zan UTSW 5 137403762 missense unknown
R5441:Zan UTSW 5 137436751 missense unknown
R5447:Zan UTSW 5 137472191 missense probably damaging 1.00
R5455:Zan UTSW 5 137454000 missense unknown
R5495:Zan UTSW 5 137470408 missense probably damaging 1.00
R5496:Zan UTSW 5 137436345 missense unknown
R5523:Zan UTSW 5 137421893 missense unknown
R5534:Zan UTSW 5 137438451 missense unknown
R5572:Zan UTSW 5 137394431 missense unknown
R5576:Zan UTSW 5 137428482 nonsense probably null
R5587:Zan UTSW 5 137391762 missense unknown
R5593:Zan UTSW 5 137468338 missense possibly damaging 0.72
R5600:Zan UTSW 5 137386971 missense unknown
R5682:Zan UTSW 5 137414259 nonsense probably null
R5712:Zan UTSW 5 137400098 missense unknown
R5751:Zan UTSW 5 137410161 intron probably null
R5782:Zan UTSW 5 137420007 missense unknown
R5835:Zan UTSW 5 137456655 missense unknown
R5846:Zan UTSW 5 137394376 splice site probably null
R5903:Zan UTSW 5 137442134 missense unknown
R5911:Zan UTSW 5 137457912 missense unknown
R5935:Zan UTSW 5 137443930 missense unknown
R5985:Zan UTSW 5 137446037 intron probably null
R5995:Zan UTSW 5 137378809 unclassified probably benign
R6012:Zan UTSW 5 137464529 missense unknown
R6077:Zan UTSW 5 137414297 unclassified probably benign
R6227:Zan UTSW 5 137468343 missense probably damaging 0.96
R6262:Zan UTSW 5 137429485 intron probably null
R6337:Zan UTSW 5 137452488 missense unknown
R6598:Zan UTSW 5 137406364 unclassified probably benign
R6725:Zan UTSW 5 137438520 missense unknown
R6765:Zan UTSW 5 137393147 missense unknown
R6820:Zan UTSW 5 137407844 unclassified probably benign
R6829:Zan UTSW 5 137416278 unclassified probably benign
R6851:Zan UTSW 5 137396191 missense unknown
R6903:Zan UTSW 5 137456304 missense unknown
R6910:Zan UTSW 5 137419080 missense unknown
R6968:Zan UTSW 5 137461813 missense unknown
R7021:Zan UTSW 5 137423951 missense unknown
R7039:Zan UTSW 5 137400134 missense unknown
R7101:Zan UTSW 5 137398290 missense unknown
R7102:Zan UTSW 5 137454200 critical splice donor site probably null
R7155:Zan UTSW 5 137461844 missense unknown
R7158:Zan UTSW 5 137400644 missense unknown
R7170:Zan UTSW 5 137463494 missense unknown
R7203:Zan UTSW 5 137434096 missense unknown
R7204:Zan UTSW 5 137427978 missense unknown
R7305:Zan UTSW 5 137415139 missense unknown
R7327:Zan UTSW 5 137465232 missense probably benign 0.35
R7340:Zan UTSW 5 137383830 missense unknown
R7360:Zan UTSW 5 137386970 missense unknown
R7385:Zan UTSW 5 137434154 nonsense probably null
R7385:Zan UTSW 5 137450491 missense unknown
R7438:Zan UTSW 5 137425562 missense unknown
R7453:Zan UTSW 5 137466002 missense probably damaging 1.00
R7483:Zan UTSW 5 137446795 missense unknown
R7499:Zan UTSW 5 137464356 missense probably benign 0.23
R7566:Zan UTSW 5 137412583 critical splice donor site probably null
R7641:Zan UTSW 5 137467108 missense possibly damaging 0.74
R7674:Zan UTSW 5 137467108 missense possibly damaging 0.74
R7678:Zan UTSW 5 137463540 missense unknown
R7785:Zan UTSW 5 137429143 missense unknown
R7814:Zan UTSW 5 137463579 missense unknown
RF013:Zan UTSW 5 137391720 missense unknown
X0062:Zan UTSW 5 137446238 missense unknown
X0066:Zan UTSW 5 137464430 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01