Incidental Mutation 'R2154:Smg1'
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene NameSMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosomal Location118131308-118243670 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 118158076 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: M2286K
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: M2286K

low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083940
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208025
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
R7798:Smg1 UTSW 7 118171939 missense possibly damaging 0.73
R7908:Smg1 UTSW 7 118186134 missense unknown
R7923:Smg1 UTSW 7 118143322 missense possibly damaging 0.96
R7978:Smg1 UTSW 7 118193655 missense unknown
R7997:Smg1 UTSW 7 118173141 missense unknown
R7997:Smg1 UTSW 7 118173142 missense unknown
R8025:Smg1 UTSW 7 118206989 nonsense probably null
R8056:Smg1 UTSW 7 118160366 missense unknown
R8061:Smg1 UTSW 7 118152387 missense unknown
R8095:Smg1 UTSW 7 118173062 missense unknown
R8198:Smg1 UTSW 7 118145606 missense probably benign 0.03
R8399:Smg1 UTSW 7 118190571 missense unknown
R8445:Smg1 UTSW 7 118136977 missense possibly damaging 0.72
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Z1176:Smg1 UTSW 7 118206887 missense unknown
Z1176:Smg1 UTSW 7 118206907 missense unknown
Z1177:Smg1 UTSW 7 118168608 missense probably null
Z1177:Smg1 UTSW 7 118213033 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01