Incidental Mutation 'R2154:Dis3l'
ID 234634
Institutional Source Beutler Lab
Gene Symbol Dis3l
Ensembl Gene ENSMUSG00000032396
Gene Name DIS3 like exosome 3'-5' exoribonuclease
Synonyms
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R2154 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 64306756-64341288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64307263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 981 (N981I)
Ref Sequence ENSEMBL: ENSMUSP00000129772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034964] [ENSMUST00000068367] [ENSMUST00000113890] [ENSMUST00000120760] [ENSMUST00000168844] [ENSMUST00000216594]
AlphaFold Q8C0S1
Predicted Effect probably benign
Transcript: ENSMUST00000034964
SMART Domains Protein: ENSMUSP00000034964
Gene: ENSMUSG00000032397

DomainStartEndE-ValueType
low complexity region 19 43 N/A INTRINSIC
Pfam:Swi3 63 143 2.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068367
AA Change: N898I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063830
Gene: ENSMUSG00000032396
AA Change: N898I

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113890
AA Change: N898I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109522
Gene: ENSMUSG00000032396
AA Change: N898I

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120760
AA Change: N898I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113503
Gene: ENSMUSG00000032396
AA Change: N898I

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168844
AA Change: N981I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129772
Gene: ENSMUSG00000032396
AA Change: N981I

DomainStartEndE-ValueType
low complexity region 208 220 N/A INTRINSIC
RNB 465 817 4.82e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216594
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic RNA exosome complex degrades unstable mRNAs and is involved in the regular turnover of other mRNAs. The protein encoded by this gene contains 3'-5' exoribonuclease activity and is a catalytic component of this complex. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Dis3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Dis3l APN 9 64319254 critical splice acceptor site probably null
IGL01812:Dis3l APN 9 64310237 missense probably benign 0.00
IGL01838:Dis3l APN 9 64308299 missense probably benign 0.41
IGL02104:Dis3l APN 9 64310329 missense possibly damaging 0.61
IGL02478:Dis3l APN 9 64314773 missense probably benign 0.00
IGL02481:Dis3l APN 9 64319080 splice site probably null
IGL02483:Dis3l APN 9 64319080 splice site probably null
IGL02965:Dis3l APN 9 64310484 missense probably damaging 0.99
IGL03139:Dis3l APN 9 64311950 missense probably damaging 0.99
IGL03054:Dis3l UTSW 9 64310440 critical splice donor site probably null
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0724:Dis3l UTSW 9 64307126 missense possibly damaging 0.92
R0801:Dis3l UTSW 9 64319154 missense probably benign
R0925:Dis3l UTSW 9 64341130 start codon destroyed probably null 0.97
R1502:Dis3l UTSW 9 64325787 missense possibly damaging 0.68
R1541:Dis3l UTSW 9 64307489 missense probably benign 0.07
R1794:Dis3l UTSW 9 64317776 missense possibly damaging 0.67
R1929:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2007:Dis3l UTSW 9 64308276 splice site probably null
R2062:Dis3l UTSW 9 64339573 missense probably benign 0.02
R2152:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2153:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2186:Dis3l UTSW 9 64339612 nonsense probably null
R2271:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2280:Dis3l UTSW 9 64317794 missense possibly damaging 0.70
R2287:Dis3l UTSW 9 64307497 missense probably benign 0.20
R3156:Dis3l UTSW 9 64311750 missense probably benign 0.25
R4664:Dis3l UTSW 9 64330798 missense unknown
R4775:Dis3l UTSW 9 64330908 missense probably benign 0.16
R4977:Dis3l UTSW 9 64307201 missense probably benign 0.00
R4997:Dis3l UTSW 9 64311942 missense possibly damaging 0.76
R5097:Dis3l UTSW 9 64319216 missense probably damaging 1.00
R5579:Dis3l UTSW 9 64330835 missense probably benign 0.44
R5623:Dis3l UTSW 9 64307603 missense possibly damaging 0.70
R6310:Dis3l UTSW 9 64322575 missense probably benign 0.00
R6442:Dis3l UTSW 9 64307555 missense probably benign
R6505:Dis3l UTSW 9 64307513 missense probably benign 0.15
R6731:Dis3l UTSW 9 64310438 splice site probably null
R7008:Dis3l UTSW 9 64310453 missense possibly damaging 0.96
R7405:Dis3l UTSW 9 64314704 missense probably damaging 1.00
R7555:Dis3l UTSW 9 64311937 nonsense probably null
R7798:Dis3l UTSW 9 64341017 missense probably benign
R7890:Dis3l UTSW 9 64322471 missense probably benign 0.00
R8329:Dis3l UTSW 9 64311830 missense possibly damaging 0.50
R8715:Dis3l UTSW 9 64307060 missense probably benign
R8942:Dis3l UTSW 9 64307593 missense probably benign 0.22
R8973:Dis3l UTSW 9 64339542 missense probably damaging 0.96
R9189:Dis3l UTSW 9 64310449 missense probably benign 0.21
R9240:Dis3l UTSW 9 64310165 critical splice donor site probably null
R9354:Dis3l UTSW 9 64314640 missense probably benign 0.01
R9394:Dis3l UTSW 9 64317735 missense probably benign 0.24
X0020:Dis3l UTSW 9 64325734 missense probably damaging 1.00
X0065:Dis3l UTSW 9 64307054 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTCCTCCAGAAGTGTGTACAG -3'
(R):5'- TCATCTCTACCACAGCTGGAG -3'

Sequencing Primer
(F):5'- AAGTGTGTACAGACTTCTTCCC -3'
(R):5'- CATCTATTTGACCATGTGACGG -3'
Posted On 2014-10-01