Mutagenetix > Incidental Mutation

Incidental Mutation 'R0196:Ephb3'

23465

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

MMRRC Submission

038455-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.901) question?

Stock #

R0196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21218054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 343 (N343I)

Ref Sequence

ENSEMBL: ENSMUSP00000006112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063] [ENSMUST00000231316] [ENSMUST00000232407]

AlphaFold

P54754

Predicted Effect

probably damaging
Transcript: ENSMUST00000006112
AA Change: N343I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: N343I

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160053

Predicted Effect

unknown
Transcript: ENSMUST00000161063
AA Change: N89I

Predicted Effect

probably benign
Transcript: ENSMUST00000231316

Predicted Effect

probably benign
Transcript: ENSMUST00000232407

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0230:Ephb3	UTSW	16	21220775	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1694:Ephb3	UTSW	16	21221745	missense	probably damaging	1.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R2378:Ephb3	UTSW	16	21218243	missense	probably benign
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4027:Ephb3	UTSW	16	21221697	missense	probably damaging	1.00
R4429:Ephb3	UTSW	16	21214463	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6020:Ephb3	UTSW	16	21222013	missense	probably damaging	0.99
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6539:Ephb3	UTSW	16	21221468	missense	probably benign
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R9092:Ephb3	UTSW	16	21222464	missense	probably benign	0.01
R9504:Ephb3	UTSW	16	21218080	missense	possibly damaging	0.48
R9706:Ephb3	UTSW	16	21220443	missense	probably damaging	1.00
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- ACCTAAGGGTGTGCTGTCTTCCTG -3'
(R):5'- CTGCCGAGGTACAAACTCTACGTTG -3'

Sequencing Primer
(F):5'- tgaggtatggaggatggagaag -3'
(R):5'- TTGTCATCGCAGCGTGAAC -3'

Posted On

2013-04-16