Incidental Mutation 'R2154:Nedd4l'
ID 234667
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 040157-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R2154 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65343401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 820 (H820Q)
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: H820Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: H820Q

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: H941Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: H941Q

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: H800Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: H820Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,208,959 (GRCm39) E363G probably benign Het
Abca3 A G 17: 24,596,693 (GRCm39) Y382C probably damaging Het
Abca5 A G 11: 110,183,000 (GRCm39) I1019T probably benign Het
Acox3 A T 5: 35,762,568 (GRCm39) S481C probably damaging Het
Ankrd7 T A 6: 18,870,030 (GRCm39) M261K probably benign Het
Aqr A C 2: 113,967,485 (GRCm39) M510R probably damaging Het
Arpc1a A T 5: 145,029,369 (GRCm39) T56S probably benign Het
Asap2 A T 12: 21,162,084 (GRCm39) T14S probably damaging Het
Aspg A G 12: 112,087,408 (GRCm39) E288G probably benign Het
Atp2c2 A G 8: 120,482,841 (GRCm39) N901S probably benign Het
Cabcoco1 A G 10: 68,267,092 (GRCm39) L205P probably damaging Het
Cant1 A G 11: 118,302,263 (GRCm39) L18P probably damaging Het
Cdca2 G A 14: 67,914,425 (GRCm39) P945S probably damaging Het
Cfap74 A G 4: 155,513,753 (GRCm39) K522E possibly damaging Het
Chek1 C A 9: 36,635,279 (GRCm39) V35F probably damaging Het
Cpa6 A T 1: 10,407,547 (GRCm39) M330K probably damaging Het
Creb3l4 G T 3: 90,145,792 (GRCm39) N246K probably damaging Het
Cyp2c55 T A 19: 39,022,819 (GRCm39) V319D probably damaging Het
Dapk1 T A 13: 60,877,317 (GRCm39) S519T probably benign Het
Dhx38 T C 8: 110,287,306 (GRCm39) S221G probably benign Het
Dis3l T A 9: 64,214,545 (GRCm39) N981I probably benign Het
Dock4 T A 12: 40,870,661 (GRCm39) V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,894,547 (GRCm39) probably benign Het
Dok5 G A 2: 170,642,816 (GRCm39) G38D probably damaging Het
Ercc6l2 T C 13: 64,013,821 (GRCm39) S631P probably damaging Het
Fat4 A T 3: 38,941,688 (GRCm39) S194C probably damaging Het
Fcsk T A 8: 111,615,704 (GRCm39) T542S probably benign Het
Garem2 T C 5: 30,313,297 (GRCm39) S54P probably damaging Het
Gdf10 T C 14: 33,656,346 (GRCm39) I436T probably damaging Het
Gfod1 T C 13: 43,456,946 (GRCm39) T10A possibly damaging Het
Gucy1a1 A G 3: 82,018,458 (GRCm39) probably null Het
Heatr5b G T 17: 79,138,873 (GRCm39) Q90K probably benign Het
Ikzf3 T A 11: 98,376,475 (GRCm39) K211* probably null Het
Itgam A C 7: 127,684,749 (GRCm39) D373A probably damaging Het
Itpripl2 A G 7: 118,089,107 (GRCm39) F484S probably damaging Het
Kat6b A T 14: 21,718,735 (GRCm39) H1138L probably benign Het
Kif16b T C 2: 142,532,500 (GRCm39) K1213R probably damaging Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Mmp25 T A 17: 23,850,048 (GRCm39) Y504F probably damaging Het
Mtf2 A G 5: 108,228,797 (GRCm39) K38E possibly damaging Het
Myh14 A C 7: 44,301,853 (GRCm39) probably null Het
Nfkb1 T C 3: 135,307,240 (GRCm39) T562A probably benign Het
Or8b49 G T 9: 38,505,707 (GRCm39) L63F probably damaging Het
Pds5a A T 5: 65,807,841 (GRCm39) V464E probably damaging Het
Peak1 C T 9: 56,114,496 (GRCm39) V452M probably damaging Het
Phf2 T C 13: 48,973,549 (GRCm39) Y372C unknown Het
Poc1a T A 9: 106,162,773 (GRCm39) probably null Het
Prss33 C T 17: 24,053,817 (GRCm39) V87M probably damaging Het
Psmc2 C G 5: 22,008,127 (GRCm39) L344V possibly damaging Het
Ptpn12 C A 5: 21,207,466 (GRCm39) Q297H probably damaging Het
Rabgap1 T C 2: 37,365,453 (GRCm39) V242A probably damaging Het
Rad1 C A 15: 10,486,721 (GRCm39) H39Q possibly damaging Het
Rad51ap2 A G 12: 11,507,986 (GRCm39) H636R probably benign Het
Samd9l C T 6: 3,372,945 (GRCm39) D1439N possibly damaging Het
Sbno1 A T 5: 124,516,574 (GRCm39) D1266E probably benign Het
Sidt2 T C 9: 45,856,638 (GRCm39) D477G probably damaging Het
Slc22a13 T C 9: 119,037,753 (GRCm39) K125R probably benign Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Slmap A G 14: 26,139,402 (GRCm39) Y771H probably damaging Het
Smg1 A T 7: 117,757,299 (GRCm39) probably benign Het
Spinkl A T 18: 44,302,194 (GRCm39) N32K probably benign Het
Stxbp1 T A 2: 32,692,868 (GRCm39) I383F probably damaging Het
Taf3 C T 2: 9,956,377 (GRCm39) E597K possibly damaging Het
Tln2 T C 9: 67,209,842 (GRCm39) T432A probably damaging Het
Tmco6 T C 18: 36,874,740 (GRCm39) V409A probably benign Het
Tstd2 T C 4: 46,129,235 (GRCm39) T198A probably damaging Het
Vmn1r230 T A 17: 21,067,063 (GRCm39) M84K probably damaging Het
Vmn1r45 T A 6: 89,910,965 (GRCm39) S2C possibly damaging Het
Vmn2r25 T A 6: 123,816,805 (GRCm39) T259S probably benign Het
Vmn2r70 A G 7: 85,212,923 (GRCm39) S495P possibly damaging Het
Vmn2r97 A T 17: 19,167,584 (GRCm39) R613* probably null Het
Yme1l1 T C 2: 23,052,520 (GRCm39) L58P probably damaging Het
Zan G A 5: 137,412,511 (GRCm39) probably benign Het
Zfhx4 A G 3: 5,466,801 (GRCm39) T2320A possibly damaging Het
Zfp407 T C 18: 84,227,774 (GRCm39) D1945G possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTCCCACAGGACTCAC -3'
(R):5'- TGCTCCCATGATGGCTTCAC -3'

Sequencing Primer
(F):5'- GCAGACCGCACTCTGAG -3'
(R):5'- GCATGCTCTGCCTACGTGTATG -3'
Posted On 2014-10-01