Mutagenetix > Incidental Mutation

Incidental Mutation 'R2154:Nedd4l'

234667

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

040157-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R2154 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65210330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 820 (H820Q)

Ref Sequence

ENSEMBL: ENSMUSP00000153526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080418
AA Change: H820Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: H820Q

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163516
AA Change: H941Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: H941Q

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000224347
AA Change: H800Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224663

Predicted Effect

probably damaging
Transcript: ENSMUST00000226058
AA Change: H820Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,455,115	E363G	probably benign	Het
Abca3	A	G	17: 24,377,719	Y382C	probably damaging	Het
Abca5	A	G	11: 110,292,174	I1019T	probably benign	Het
Acox3	A	T	5: 35,605,224	S481C	probably damaging	Het
Ankrd7	T	A	6: 18,870,031	M261K	probably benign	Het
Aqr	A	C	2: 114,137,004	M510R	probably damaging	Het
Arpc1a	A	T	5: 145,092,559	T56S	probably benign	Het
Asap2	A	T	12: 21,112,083	T14S	probably damaging	Het
Aspg	A	G	12: 112,120,974	E288G	probably benign	Het
Atp2c2	A	G	8: 119,756,102	N901S	probably benign	Het
Cabcoco1	A	G	10: 68,431,262	L205P	probably damaging	Het
Cant1	A	G	11: 118,411,437	L18P	probably damaging	Het
Cdca2	G	A	14: 67,676,976	P945S	probably damaging	Het
Cfap74	A	G	4: 155,429,296	K522E	possibly damaging	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cpa6	A	T	1: 10,337,322	M330K	probably damaging	Het
Creb3l4	G	T	3: 90,238,485	N246K	probably damaging	Het
Cyp2c55	T	A	19: 39,034,375	V319D	probably damaging	Het
Dapk1	T	A	13: 60,729,503	S519T	probably benign	Het
Dhx38	T	C	8: 109,560,674	S221G	probably benign	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dock4	T	A	12: 40,820,662	V1467E	probably damaging	Het
Dock4	ACCTGCTCTGCC	ACCTGCTCTGCCTGCTCTGCC	12: 40,844,548		probably benign	Het
Dok5	G	A	2: 170,800,896	G38D	probably damaging	Het
Ercc6l2	T	C	13: 63,866,007	S631P	probably damaging	Het
Fat4	A	T	3: 38,887,539	S194C	probably damaging	Het
Fuk	T	A	8: 110,889,072	T542S	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gdf10	T	C	14: 33,934,389	I436T	probably damaging	Het
Gfod1	T	C	13: 43,303,470	T10A	possibly damaging	Het
Gucy1a1	A	G	3: 82,111,151		probably null	Het
Heatr5b	G	T	17: 78,831,444	Q90K	probably benign	Het
Ikzf3	T	A	11: 98,485,649	K211*	probably null	Het
Itgam	A	C	7: 128,085,577	D373A	probably damaging	Het
Itpripl2	A	G	7: 118,489,884	F484S	probably damaging	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kif16b	T	C	2: 142,690,580	K1213R	probably damaging	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Mmp25	T	A	17: 23,631,074	Y504F	probably damaging	Het
Mtf2	A	G	5: 108,080,931	K38E	possibly damaging	Het
Myh14	A	C	7: 44,652,429		probably null	Het
Nfkb1	T	C	3: 135,601,479	T562A	probably benign	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Pds5a	A	T	5: 65,650,498	V464E	probably damaging	Het
Peak1	C	T	9: 56,207,212	V452M	probably damaging	Het
Phf2	T	C	13: 48,820,073	Y372C	unknown	Het
Poc1a	T	A	9: 106,285,574		probably null	Het
Prss33	C	T	17: 23,834,843	V87M	probably damaging	Het
Psmc2	C	G	5: 21,803,129	L344V	possibly damaging	Het
Ptpn12	C	A	5: 21,002,468	Q297H	probably damaging	Het
Rabgap1	T	C	2: 37,475,441	V242A	probably damaging	Het
Rad1	C	A	15: 10,486,635	H39Q	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,985	H636R	probably benign	Het
Samd9l	C	T	6: 3,372,945	D1439N	possibly damaging	Het
Sbno1	A	T	5: 124,378,511	D1266E	probably benign	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc22a13	T	C	9: 119,208,687	K125R	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Smg1	A	T	7: 118,158,076		probably benign	Het
Spinkl	A	T	18: 44,169,127	N32K	probably benign	Het
Stxbp1	T	A	2: 32,802,856	I383F	probably damaging	Het
Taf3	C	T	2: 9,951,566	E597K	possibly damaging	Het
Tln2	T	C	9: 67,302,560	T432A	probably damaging	Het
Tmco6	T	C	18: 36,741,687	V409A	probably benign	Het
Tstd2	T	C	4: 46,129,235	T198A	probably damaging	Het
Vmn1r230	T	A	17: 20,846,801	M84K	probably damaging	Het
Vmn1r45	T	A	6: 89,933,983	S2C	possibly damaging	Het
Vmn2r25	T	A	6: 123,839,846	T259S	probably benign	Het
Vmn2r70	A	G	7: 85,563,715	S495P	possibly damaging	Het
Vmn2r97	A	T	17: 18,947,322	R613*	probably null	Het
Yme1l1	T	C	2: 23,162,508	L58P	probably damaging	Het
Zan	G	A	5: 137,414,249		probably benign	Het
Zfhx4	A	G	3: 5,401,741	T2320A	possibly damaging	Het
Zfp407	T	C	18: 84,209,649	D1945G	possibly damaging	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1643:Nedd4l	UTSW	18	65198641	missense	probably damaging	1.00
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2070:Nedd4l	UTSW	18	65212820	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3711:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5106:Nedd4l	UTSW	18	65193305	missense	probably damaging	1.00
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6465:Nedd4l	UTSW	18	65155264	missense	probably benign	0.06
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7065:Nedd4l	UTSW	18	65195969	missense	probably benign	0.04
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7496:Nedd4l	UTSW	18	65080018	missense	possibly damaging	0.94
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATTTCCCACAGGACTCAC -3'
(R):5'- TGCTCCCATGATGGCTTCAC -3'

Sequencing Primer
(F):5'- GCAGACCGCACTCTGAG -3'
(R):5'- GCATGCTCTGCCTACGTGTATG -3'

Posted On

2014-10-01