Mutagenetix > Incidental Mutation

Incidental Mutation 'R2154:Zfp407'

234668

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

MMRRC Submission

040157-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2154 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84209649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1945 (D1945G)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

AlphaFold

G3UVV3

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125763
AA Change: D1945G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: D1945G

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Meta Mutation Damage Score

0.0761

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	A	G	8: 72,455,115	E363G	probably benign	Het
Abca3	A	G	17: 24,377,719	Y382C	probably damaging	Het
Abca5	A	G	11: 110,292,174	I1019T	probably benign	Het
Acox3	A	T	5: 35,605,224	S481C	probably damaging	Het
Ankrd7	T	A	6: 18,870,031	M261K	probably benign	Het
Aqr	A	C	2: 114,137,004	M510R	probably damaging	Het
Arpc1a	A	T	5: 145,092,559	T56S	probably benign	Het
Asap2	A	T	12: 21,112,083	T14S	probably damaging	Het
Aspg	A	G	12: 112,120,974	E288G	probably benign	Het
Atp2c2	A	G	8: 119,756,102	N901S	probably benign	Het
Cabcoco1	A	G	10: 68,431,262	L205P	probably damaging	Het
Cant1	A	G	11: 118,411,437	L18P	probably damaging	Het
Cdca2	G	A	14: 67,676,976	P945S	probably damaging	Het
Cfap74	A	G	4: 155,429,296	K522E	possibly damaging	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cpa6	A	T	1: 10,337,322	M330K	probably damaging	Het
Creb3l4	G	T	3: 90,238,485	N246K	probably damaging	Het
Cyp2c55	T	A	19: 39,034,375	V319D	probably damaging	Het
Dapk1	T	A	13: 60,729,503	S519T	probably benign	Het
Dhx38	T	C	8: 109,560,674	S221G	probably benign	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dock4	T	A	12: 40,820,662	V1467E	probably damaging	Het
Dock4	ACCTGCTCTGCC	ACCTGCTCTGCCTGCTCTGCC	12: 40,844,548		probably benign	Het
Dok5	G	A	2: 170,800,896	G38D	probably damaging	Het
Ercc6l2	T	C	13: 63,866,007	S631P	probably damaging	Het
Fat4	A	T	3: 38,887,539	S194C	probably damaging	Het
Fuk	T	A	8: 110,889,072	T542S	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gdf10	T	C	14: 33,934,389	I436T	probably damaging	Het
Gfod1	T	C	13: 43,303,470	T10A	possibly damaging	Het
Gucy1a1	A	G	3: 82,111,151		probably null	Het
Heatr5b	G	T	17: 78,831,444	Q90K	probably benign	Het
Ikzf3	T	A	11: 98,485,649	K211*	probably null	Het
Itgam	A	C	7: 128,085,577	D373A	probably damaging	Het
Itpripl2	A	G	7: 118,489,884	F484S	probably damaging	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kif16b	T	C	2: 142,690,580	K1213R	probably damaging	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Mmp25	T	A	17: 23,631,074	Y504F	probably damaging	Het
Mtf2	A	G	5: 108,080,931	K38E	possibly damaging	Het
Myh14	A	C	7: 44,652,429		probably null	Het
Nedd4l	T	A	18: 65,210,330	H820Q	probably damaging	Het
Nfkb1	T	C	3: 135,601,479	T562A	probably benign	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Pds5a	A	T	5: 65,650,498	V464E	probably damaging	Het
Peak1	C	T	9: 56,207,212	V452M	probably damaging	Het
Phf2	T	C	13: 48,820,073	Y372C	unknown	Het
Poc1a	T	A	9: 106,285,574		probably null	Het
Prss33	C	T	17: 23,834,843	V87M	probably damaging	Het
Psmc2	C	G	5: 21,803,129	L344V	possibly damaging	Het
Ptpn12	C	A	5: 21,002,468	Q297H	probably damaging	Het
Rabgap1	T	C	2: 37,475,441	V242A	probably damaging	Het
Rad1	C	A	15: 10,486,635	H39Q	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,985	H636R	probably benign	Het
Samd9l	C	T	6: 3,372,945	D1439N	possibly damaging	Het
Sbno1	A	T	5: 124,378,511	D1266E	probably benign	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc22a13	T	C	9: 119,208,687	K125R	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Smg1	A	T	7: 118,158,076		probably benign	Het
Spinkl	A	T	18: 44,169,127	N32K	probably benign	Het
Stxbp1	T	A	2: 32,802,856	I383F	probably damaging	Het
Taf3	C	T	2: 9,951,566	E597K	possibly damaging	Het
Tln2	T	C	9: 67,302,560	T432A	probably damaging	Het
Tmco6	T	C	18: 36,741,687	V409A	probably benign	Het
Tstd2	T	C	4: 46,129,235	T198A	probably damaging	Het
Vmn1r230	T	A	17: 20,846,801	M84K	probably damaging	Het
Vmn1r45	T	A	6: 89,933,983	S2C	possibly damaging	Het
Vmn2r25	T	A	6: 123,839,846	T259S	probably benign	Het
Vmn2r70	A	G	7: 85,563,715	S495P	possibly damaging	Het
Vmn2r97	A	T	17: 18,947,322	R613*	probably null	Het
Yme1l1	T	C	2: 23,162,508	L58P	probably damaging	Het
Zan	G	A	5: 137,414,249		probably benign	Het
Zfhx4	A	G	3: 5,401,741	T2320A	possibly damaging	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7942:Zfp407	UTSW	18	84559629	missense	probably benign	0.02
R7955:Zfp407	UTSW	18	84559291	missense	probably benign	0.02
R7988:Zfp407	UTSW	18	84559400	missense	possibly damaging	0.60
R8125:Zfp407	UTSW	18	84561185	missense	probably damaging	1.00
R8237:Zfp407	UTSW	18	84560144	missense	possibly damaging	0.87
R8364:Zfp407	UTSW	18	84552868	critical splice donor site	probably null
R8443:Zfp407	UTSW	18	84209862	missense	probably damaging	1.00
R8487:Zfp407	UTSW	18	84562770	nonsense	probably null
R8497:Zfp407	UTSW	18	84559896	missense	probably damaging	0.98
R8808:Zfp407	UTSW	18	84343060	missense	probably benign	0.17
R8848:Zfp407	UTSW	18	84560694	missense	probably damaging	1.00
R8913:Zfp407	UTSW	18	84560528	missense	probably damaging	0.99
R8962:Zfp407	UTSW	18	84558932	missense	probably damaging	1.00
R9087:Zfp407	UTSW	18	84209857	missense	probably damaging	0.96
R9452:Zfp407	UTSW	18	84562454	missense	probably benign	0.02
R9691:Zfp407	UTSW	18	84560187	missense	probably benign	0.03
R9766:Zfp407	UTSW	18	84559449	missense	probably benign	0.06
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGGATCAGCACGTCCTTGTG -3'
(R):5'- CATCATCATCCAGGGCTACG -3'

Sequencing Primer
(F):5'- GGCTGGGCCGACCTTTTTC -3'
(R):5'- ATCATCCAGGGCTACGATGGC -3'

Posted On

2014-10-01