Incidental Mutation 'R2155:Smg7'
ID234676
Institutional Source Beutler Lab
Gene Symbol Smg7
Ensembl Gene ENSMUSG00000042772
Gene NameSmg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms9430023P16Rik
MMRRC Submission 040158-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R2155 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location152836995-152902646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152840313 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1057 (T1057I)
Ref Sequence ENSEMBL: ENSMUSP00000041241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000043560] [ENSMUST00000073441] [ENSMUST00000111836] [ENSMUST00000186568]
Predicted Effect probably benign
Transcript: ENSMUST00000027754
SMART Domains Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043560
AA Change: T1057I

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041241
Gene: ENSMUSG00000042772
AA Change: T1057I

DomainStartEndE-ValueType
Pfam:EST1 63 177 3.4e-30 PFAM
Pfam:EST1_DNA_bind 179 438 3.3e-64 PFAM
low complexity region 457 465 N/A INTRINSIC
low complexity region 615 633 N/A INTRINSIC
low complexity region 682 710 N/A INTRINSIC
low complexity region 711 729 N/A INTRINSIC
low complexity region 874 898 N/A INTRINSIC
low complexity region 906 922 N/A INTRINSIC
low complexity region 931 947 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073441
AA Change: T1045I

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073144
Gene: ENSMUSG00000042772
AA Change: T1045I

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.6e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 653 671 N/A INTRINSIC
low complexity region 720 748 N/A INTRINSIC
low complexity region 749 767 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 996 1022 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111836
AA Change: T1049I

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107467
Gene: ENSMUSG00000042772
AA Change: T1049I

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.7e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 674 702 N/A INTRINSIC
low complexity region 703 721 N/A INTRINSIC
low complexity region 866 890 N/A INTRINSIC
low complexity region 898 914 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
low complexity region 1000 1026 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186568
SMART Domains Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186900
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is essential for nonsense-mediated mRNA decay (NMD); a process whereby transcripts with premature termination codons are targeted for rapid degradation by a mRNA decay complex. The mRNA decay complex consists, in part, of this protein along with proteins SMG5 and UPF1. The N-terminal domain of this protein is thought to mediate its association with SMG5 or UPF1 while the C-terminal domain interacts with the mRNA decay complex. This protein may therefore couple changes in UPF1 phosphorylation state to the degradation of NMD-candidate transcripts. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A G 16: 17,121,396 L41P probably damaging Het
Aff4 C T 11: 53,399,619 L469F probably damaging Het
AI182371 G A 2: 35,085,354 H288Y probably benign Het
AK157302 A T 13: 21,495,657 K118* probably null Het
Arhgef2 G A 3: 88,636,044 R454Q probably damaging Het
Asb17 C T 3: 153,844,685 T118M probably damaging Het
Atp7b A G 8: 22,013,584 V718A possibly damaging Het
BC003331 A G 1: 150,382,335 V183A possibly damaging Het
Cdca2 A G 14: 67,714,838 L28S probably damaging Het
Cdh7 G T 1: 110,048,864 L86F probably damaging Het
Cela2a A T 4: 141,818,039 probably null Het
Cers3 T A 7: 66,783,414 Y160N probably damaging Het
Chmp2b A G 16: 65,546,991 V56A probably benign Het
Cryl1 A G 14: 57,398,423 V9A unknown Het
Dmbt1 A T 7: 131,097,575 H978L possibly damaging Het
Dnm1 C T 2: 32,314,937 V673M probably damaging Het
Dtx4 T A 19: 12,485,282 K378* probably null Het
Extl1 A T 4: 134,363,180 M328K possibly damaging Het
Fcgbp T C 7: 28,107,203 S2199P probably benign Het
Glis3 G T 19: 28,531,302 N427K probably benign Het
Gm6614 T C 6: 141,980,944 D552G probably damaging Het
Gm884 T C 11: 103,620,459 T228A unknown Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hesx1 A G 14: 27,001,477 E88G probably benign Het
Hmcn2 A T 2: 31,460,349 Q5086L possibly damaging Het
Ier3 A G 17: 35,822,209 T128A probably benign Het
Igsf10 G T 3: 59,331,680 T360K probably damaging Het
Ilkap A C 1: 91,384,623 C2G possibly damaging Het
Itih1 A G 14: 30,938,071 F231S probably damaging Het
Jrkl A T 9: 13,244,908 Y249* probably null Het
Kat6a AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 8: 22,935,647 probably benign Het
Katnal2 A T 18: 77,010,941 S184R probably benign Het
Kcnh5 T A 12: 74,898,456 probably null Het
Kcnj11 G T 7: 46,099,357 L181I probably damaging Het
Klhl2 T C 8: 64,749,770 T465A probably benign Het
Krt90 T A 15: 101,562,611 Y72F probably benign Het
Lig4 G A 8: 9,972,766 T338I probably benign Het
Magel2 T C 7: 62,380,792 V1148A unknown Het
Mak C A 13: 41,032,544 E549D probably benign Het
Marf1 G T 16: 14,132,429 S1001Y probably damaging Het
Mcoln1 G A 8: 3,511,787 V446I probably damaging Het
Meig1 T C 2: 3,409,253 N70S probably benign Het
Mfsd14a G A 3: 116,647,830 T108I probably damaging Het
Mocs1 G A 17: 49,454,358 M493I probably damaging Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Myh6 A T 14: 54,953,794 D863E probably benign Het
Myom2 T A 8: 15,084,555 Y453N probably damaging Het
Nhlh1 A G 1: 172,053,957 I114T probably damaging Het
Olfr131 G T 17: 38,082,180 P266Q probably damaging Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr508 C G 7: 108,630,777 P262A probably damaging Het
Olfr533 A C 7: 140,466,591 H130P probably benign Het
Olfr729 A T 14: 50,148,697 M59K probably damaging Het
Pclo T C 5: 14,714,295 S976P probably benign Het
Pde3a G A 6: 141,483,914 E734K possibly damaging Het
Pdzd2 A T 15: 12,375,793 S1419T probably benign Het
Pdzd8 T A 19: 59,300,421 Y849F probably damaging Het
Phldb3 A G 7: 24,612,645 E128G probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Ppp1r35 T C 5: 137,780,005 M254T probably benign Het
Ppp3ca G T 3: 136,890,450 R292M possibly damaging Het
Ptk7 T A 17: 46,579,617 T430S probably benign Het
Ptrh1 T A 2: 32,777,028 N144K possibly damaging Het
Rbfox1 A G 16: 7,294,082 T211A possibly damaging Het
Rbpjl A G 2: 164,414,423 D443G possibly damaging Het
Rcc1 A G 4: 132,338,049 probably null Het
Rimbp2 G T 5: 128,788,165 S706R probably damaging Het
Rsph10b G C 5: 143,961,256 E96D probably benign Het
Scn10a A T 9: 119,609,448 I1784K probably benign Het
Sfxn2 A G 19: 46,591,546 probably null Het
Slamf6 T A 1: 171,938,008 L233Q probably damaging Het
Slc17a5 A T 9: 78,577,173 Y102N probably damaging Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Speer2 T A 16: 69,860,597 T53S possibly damaging Het
Srm A C 4: 148,592,491 I100L probably benign Het
Stoml3 A C 3: 53,507,587 N267H probably damaging Het
Thsd7a A C 6: 12,379,633 C931G probably damaging Het
Tlr11 A G 14: 50,360,682 I42V probably benign Het
Tmigd1 T C 11: 76,910,173 V162A probably benign Het
Tmx3 A G 18: 90,510,381 probably null Het
Topors T A 4: 40,262,790 R165W possibly damaging Het
Ttc17 A T 2: 94,366,642 S453R possibly damaging Het
Vmn1r49 G T 6: 90,072,459 T187N probably damaging Het
Zbtb49 A T 5: 38,214,120 V139E possibly damaging Het
Zfp11 T C 5: 129,657,152 H415R probably damaging Het
Zfp677 A T 17: 21,397,708 K342N probably benign Het
Zfp979 A C 4: 147,613,458 C265G possibly damaging Het
Zfpl1 T C 19: 6,084,429 R9G probably damaging Het
Zkscan8 A T 13: 21,520,589 C321* probably null Het
Other mutations in Smg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Smg7 APN 1 152844061 missense possibly damaging 0.68
IGL02320:Smg7 APN 1 152868337 missense possibly damaging 0.49
IGL02336:Smg7 APN 1 152843279 missense probably benign
IGL02680:Smg7 APN 1 152845394 missense probably benign 0.15
IGL03232:Smg7 APN 1 152840156 missense probably damaging 1.00
chill UTSW 1 152840136 unclassified probably null
R0322:Smg7 UTSW 1 152849873 critical splice donor site probably null
R0540:Smg7 UTSW 1 152855962 missense probably benign 0.00
R0685:Smg7 UTSW 1 152866648 missense probably damaging 1.00
R0707:Smg7 UTSW 1 152870757 splice site probably null
R1109:Smg7 UTSW 1 152845583 missense probably damaging 1.00
R1118:Smg7 UTSW 1 152866575 splice site probably benign
R1119:Smg7 UTSW 1 152866575 splice site probably benign
R1458:Smg7 UTSW 1 152855843 splice site probably null
R1759:Smg7 UTSW 1 152848846 missense probably benign 0.20
R1846:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R2015:Smg7 UTSW 1 152860508 missense probably damaging 1.00
R2199:Smg7 UTSW 1 152854328 missense probably damaging 1.00
R2234:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R2235:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R3861:Smg7 UTSW 1 152852598 missense probably null 1.00
R4597:Smg7 UTSW 1 152840301 critical splice donor site probably null
R4672:Smg7 UTSW 1 152845413 missense probably damaging 1.00
R4851:Smg7 UTSW 1 152844269 missense probably benign 0.00
R5486:Smg7 UTSW 1 152846176 missense probably damaging 0.97
R5607:Smg7 UTSW 1 152843234 missense probably damaging 0.98
R6131:Smg7 UTSW 1 152845211 critical splice donor site probably null
R6396:Smg7 UTSW 1 152848600 missense probably benign 0.33
R6401:Smg7 UTSW 1 152840136 unclassified probably null
R6905:Smg7 UTSW 1 152850006 splice site probably null
R6961:Smg7 UTSW 1 152841583 nonsense probably null
R7051:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R7124:Smg7 UTSW 1 152878080 missense probably benign 0.01
R7146:Smg7 UTSW 1 152861825 missense probably benign 0.34
R7573:Smg7 UTSW 1 152859489 missense probably damaging 1.00
R7578:Smg7 UTSW 1 152845430 missense probably damaging 1.00
R7621:Smg7 UTSW 1 152841544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTCTCAGATGATGACGTTGC -3'
(R):5'- CAGACAGACTGCTTCATGGTC -3'

Sequencing Primer
(F):5'- CGTTGCTGAGAGATAATCAACAC -3'
(R):5'- ACAGACTGCTTCATGGTCTTTATTTG -3'
Posted On2014-10-01