Mutagenetix > Incidental Mutations

Incidental Mutation 'R2155:Slamf6'

234677

Institutional Source

Beutler Lab

Gene Symbol

Slamf6

Ensembl Gene

ENSMUSG00000015314

Gene Name

SLAM family member 6

Synonyms

Ly108, SF2000, KAL1, KAL1b, NTB-A

MMRRC Submission

040158-MU

Accession Numbers

NCBI RefSeq: NM_030710.2; MGI:1353620

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R2155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

171917515-171953170 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 171938008 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 233 (L233Q)

Ref Sequence

ENSEMBL: ENSMUSP00000141448 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171330] [ENSMUST00000194182] [ENSMUST00000194561] [ENSMUST00000195656]

Predicted Effect

probably damaging
Transcript: ENSMUST00000171330
AA Change: L233Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130610
Gene: ENSMUSG00000015314
AA Change: L233Q

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	1.49e-2	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	7e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193311

Predicted Effect

probably benign
Transcript: ENSMUST00000194182

SMART Domains

Protein: ENSMUSP00000142242
Gene: ENSMUSG00000015314

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000194561
AA Change: L233Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141944
Gene: ENSMUSG00000015314
AA Change: L233Q

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	1.49e-2	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	5e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195206

Predicted Effect

probably damaging
Transcript: ENSMUST00000195656
AA Change: L233Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141448
Gene: ENSMUSG00000015314
AA Change: L233Q

Domain	Start	End	E-Value	Type
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	5.9e-5	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	8e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

Strain: 3581614
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one null allele show no overt phenotype. Mice homozygous for another null allele show impaired IL-4 production by CD4+ T cells, reduced inflammatory response to L. mexicana infection, high susceptibility to S. typhimurium infection, and defective neutrophil bactericidal activity. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	G	16: 17,121,396	L41P	probably damaging	Het
Aff4	C	T	11: 53,399,619	L469F	probably damaging	Het
AI182371	G	A	2: 35,085,354	H288Y	probably benign	Het
AK157302	A	T	13: 21,495,657	K118*	probably null	Het
Arhgef2	G	A	3: 88,636,044	R454Q	probably damaging	Het
Asb17	C	T	3: 153,844,685	T118M	probably damaging	Het
Atp7b	A	G	8: 22,013,584	V718A	possibly damaging	Het
BC003331	A	G	1: 150,382,335	V183A	possibly damaging	Het
Cdca2	A	G	14: 67,714,838	L28S	probably damaging	Het
Cdh7	G	T	1: 110,048,864	L86F	probably damaging	Het
Cela2a	A	T	4: 141,818,039		probably null	Het
Cers3	T	A	7: 66,783,414	Y160N	probably damaging	Het
Chmp2b	A	G	16: 65,546,991	V56A	probably benign	Het
Cryl1	A	G	14: 57,398,423	V9A	unknown	Het
Dmbt1	A	T	7: 131,097,575	H978L	possibly damaging	Het
Dnm1	C	T	2: 32,314,937	V673M	probably damaging	Het
Dtx4	T	A	19: 12,485,282	K378*	probably null	Het
Extl1	A	T	4: 134,363,180	M328K	possibly damaging	Het
Fcgbp	T	C	7: 28,107,203	S2199P	probably benign	Het
Glis3	G	T	19: 28,531,302	N427K	probably benign	Het
Gm6614	T	C	6: 141,980,944	D552G	probably damaging	Het
Gm884	T	C	11: 103,620,459	T228A	unknown	Het
Hdac7	T	C	15: 97,794,063	K810E	probably benign	Het
Hesx1	A	G	14: 27,001,477	E88G	probably benign	Het
Hmcn2	A	T	2: 31,460,349	Q5086L	possibly damaging	Het
Ier3	A	G	17: 35,822,209	T128A	probably benign	Het
Igsf10	G	T	3: 59,331,680	T360K	probably damaging	Het
Ilkap	A	C	1: 91,384,623	C2G	possibly damaging	Het
Itih1	A	G	14: 30,938,071	F231S	probably damaging	Het
Jrkl	A	T	9: 13,244,908	Y249*	probably null	Het
Kat6a	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	8: 22,935,647		probably benign	Het
Katnal2	A	T	18: 77,010,941	S184R	probably benign	Het
Kcnh5	T	A	12: 74,898,456		probably null	Het
Kcnj11	G	T	7: 46,099,357	L181I	probably damaging	Het
Klhl2	T	C	8: 64,749,770	T465A	probably benign	Het
Krt90	T	A	15: 101,562,611	Y72F	probably benign	Het
Lig4	G	A	8: 9,972,766	T338I	probably benign	Het
Magel2	T	C	7: 62,380,792	V1148A	unknown	Het
Mak	C	A	13: 41,032,544	E549D	probably benign	Het
Marf1	G	T	16: 14,132,429	S1001Y	probably damaging	Het
Mcoln1	G	A	8: 3,511,787	V446I	probably damaging	Het
Meig1	T	C	2: 3,409,253	N70S	probably benign	Het
Mfsd14a	G	A	3: 116,647,830	T108I	probably damaging	Het
Mocs1	G	A	17: 49,454,358	M493I	probably damaging	Het
Mrpl11	C	A	19: 4,962,469	A26E	probably damaging	Het
Myh6	A	T	14: 54,953,794	D863E	probably benign	Het
Myom2	T	A	8: 15,084,555	Y453N	probably damaging	Het
Nhlh1	A	G	1: 172,053,957	I114T	probably damaging	Het
Olfr131	G	T	17: 38,082,180	P266Q	probably damaging	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr508	C	G	7: 108,630,777	P262A	probably damaging	Het
Olfr533	A	C	7: 140,466,591	H130P	probably benign	Het
Olfr729	A	T	14: 50,148,697	M59K	probably damaging	Het
Pclo	T	C	5: 14,714,295	S976P	probably benign	Het
Pde3a	G	A	6: 141,483,914	E734K	possibly damaging	Het
Pdzd2	A	T	15: 12,375,793	S1419T	probably benign	Het
Pdzd8	T	A	19: 59,300,421	Y849F	probably damaging	Het
Phldb3	A	G	7: 24,612,645	E128G	probably damaging	Het
Polg	A	G	7: 79,461,720	I261T	possibly damaging	Het
Ppp1r35	T	C	5: 137,780,005	M254T	probably benign	Het
Ppp3ca	G	T	3: 136,890,450	R292M	possibly damaging	Het
Ptk7	T	A	17: 46,579,617	T430S	probably benign	Het
Ptrh1	T	A	2: 32,777,028	N144K	possibly damaging	Het
Rbfox1	A	G	16: 7,294,082	T211A	possibly damaging	Het
Rbpjl	A	G	2: 164,414,423	D443G	possibly damaging	Het
Rcc1	A	G	4: 132,338,049		probably null	Het
Rimbp2	G	T	5: 128,788,165	S706R	probably damaging	Het
Rsph10b	G	C	5: 143,961,256	E96D	probably benign	Het
Scn10a	A	T	9: 119,609,448	I1784K	probably benign	Het
Sfxn2	A	G	19: 46,591,546		probably null	Het
Slc17a5	A	T	9: 78,577,173	Y102N	probably damaging	Het
Slc25a53	T	C	X: 136,983,467	T42A	probably damaging	Het
Smg7	G	A	1: 152,840,313	T1057I	possibly damaging	Het
Speer2	T	A	16: 69,860,597	T53S	possibly damaging	Het
Srm	A	C	4: 148,592,491	I100L	probably benign	Het
Stoml3	A	C	3: 53,507,587	N267H	probably damaging	Het
Thsd7a	A	C	6: 12,379,633	C931G	probably damaging	Het
Tlr11	A	G	14: 50,360,682	I42V	probably benign	Het
Tmigd1	T	C	11: 76,910,173	V162A	probably benign	Het
Tmx3	A	G	18: 90,510,381		probably null	Het
Topors	T	A	4: 40,262,790	R165W	possibly damaging	Het
Ttc17	A	T	2: 94,366,642	S453R	possibly damaging	Het
Vmn1r49	G	T	6: 90,072,459	T187N	probably damaging	Het
Zbtb49	A	T	5: 38,214,120	V139E	possibly damaging	Het
Zfp11	T	C	5: 129,657,152	H415R	probably damaging	Het
Zfp677	A	T	17: 21,397,708	K342N	probably benign	Het
Zfp979	A	C	4: 147,613,458	C265G	possibly damaging	Het
Zfpl1	T	C	19: 6,084,429	R9G	probably damaging	Het
Zkscan8	A	T	13: 21,520,589	C321*	probably null	Het

Other mutations in Slamf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Slamf6	APN	1	171917780	missense	probably null	0.27
IGL01011:Slamf6	APN	1	171938099	missense	probably benign	0.19
P0016:Slamf6	UTSW	1	171936501	missense	probably damaging	0.97
R1565:Slamf6	UTSW	1	171934408	missense	possibly damaging	0.53
R1763:Slamf6	UTSW	1	171942587	intron	probably benign
R1774:Slamf6	UTSW	1	171942587	intron	probably benign
R1993:Slamf6	UTSW	1	171934209	missense	possibly damaging	0.74
R2328:Slamf6	UTSW	1	171934251	missense	probably benign	0.00
R4693:Slamf6	UTSW	1	171934113	nonsense	probably null
R5062:Slamf6	UTSW	1	171936533	missense	possibly damaging	0.93
R5172:Slamf6	UTSW	1	171936580	missense	probably benign	0.01
R5249:Slamf6	UTSW	1	171936682	missense	probably damaging	1.00
R5328:Slamf6	UTSW	1	171938095	missense	probably benign	0.04
R5771:Slamf6	UTSW	1	171917774	missense	probably damaging	0.98
R6339:Slamf6	UTSW	1	171948048	missense	probably null	1.00
R6960:Slamf6	UTSW	1	171917753	missense	probably damaging	0.98
R7176:Slamf6	UTSW	1	171934291	missense	probably benign	0.13
R7400:Slamf6	UTSW	1	171919793	missense	unknown
R7535:Slamf6	UTSW	1	171919758	missense	unknown
R7629:Slamf6	UTSW	1	171936624	missense	probably damaging	0.97
RF025:Slamf6	UTSW	1	171941582	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTGCATCTCAGAAAGCCTG -3'
(R):5'- AATTCAGCCAGAAGTTGTGTCC -3'

Sequencing Primer
(F):5'- TGACAGATCCCCAGACTGCG -3'
(R):5'- AGCCAGAAGTTGTGTCCATCCTC -3'

Posted On

2014-10-01