Incidental Mutation 'R2155:Ptrh1'
ID234682
Institutional Source Beutler Lab
Gene Symbol Ptrh1
Ensembl Gene ENSMUSG00000053746
Gene Namepeptidyl-tRNA hydrolase 1 homolog
Synonyms2210013M04Rik
MMRRC Submission 040158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R2155 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32775786-32777597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32777028 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 144 (N144K)
Ref Sequence ENSEMBL: ENSMUSP00000068850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066352] [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000102813] [ENSMUST00000125891] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950] [ENSMUST00000161958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066352
AA Change: N144K

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068850
Gene: ENSMUSG00000053746
AA Change: N144K

DomainStartEndE-ValueType
Pfam:Pept_tRNA_hydro 22 200 6.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066478
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102813
SMART Domains Protein: ENSMUSP00000099877
Gene: ENSMUSG00000038987

DomainStartEndE-ValueType
coiled coil region 32 191 N/A INTRINSIC
coiled coil region 301 371 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123674
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150918
Predicted Effect probably benign
Transcript: ENSMUST00000161089
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161430
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161950
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192262
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A G 16: 17,121,396 L41P probably damaging Het
Aff4 C T 11: 53,399,619 L469F probably damaging Het
AI182371 G A 2: 35,085,354 H288Y probably benign Het
AK157302 A T 13: 21,495,657 K118* probably null Het
Arhgef2 G A 3: 88,636,044 R454Q probably damaging Het
Asb17 C T 3: 153,844,685 T118M probably damaging Het
Atp7b A G 8: 22,013,584 V718A possibly damaging Het
BC003331 A G 1: 150,382,335 V183A possibly damaging Het
Cdca2 A G 14: 67,714,838 L28S probably damaging Het
Cdh7 G T 1: 110,048,864 L86F probably damaging Het
Cela2a A T 4: 141,818,039 probably null Het
Cers3 T A 7: 66,783,414 Y160N probably damaging Het
Chmp2b A G 16: 65,546,991 V56A probably benign Het
Cryl1 A G 14: 57,398,423 V9A unknown Het
Dmbt1 A T 7: 131,097,575 H978L possibly damaging Het
Dnm1 C T 2: 32,314,937 V673M probably damaging Het
Dtx4 T A 19: 12,485,282 K378* probably null Het
Extl1 A T 4: 134,363,180 M328K possibly damaging Het
Fcgbp T C 7: 28,107,203 S2199P probably benign Het
Glis3 G T 19: 28,531,302 N427K probably benign Het
Gm6614 T C 6: 141,980,944 D552G probably damaging Het
Gm884 T C 11: 103,620,459 T228A unknown Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hesx1 A G 14: 27,001,477 E88G probably benign Het
Hmcn2 A T 2: 31,460,349 Q5086L possibly damaging Het
Ier3 A G 17: 35,822,209 T128A probably benign Het
Igsf10 G T 3: 59,331,680 T360K probably damaging Het
Ilkap A C 1: 91,384,623 C2G possibly damaging Het
Itih1 A G 14: 30,938,071 F231S probably damaging Het
Jrkl A T 9: 13,244,908 Y249* probably null Het
Kat6a AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 8: 22,935,647 probably benign Het
Katnal2 A T 18: 77,010,941 S184R probably benign Het
Kcnh5 T A 12: 74,898,456 probably null Het
Kcnj11 G T 7: 46,099,357 L181I probably damaging Het
Klhl2 T C 8: 64,749,770 T465A probably benign Het
Krt90 T A 15: 101,562,611 Y72F probably benign Het
Lig4 G A 8: 9,972,766 T338I probably benign Het
Magel2 T C 7: 62,380,792 V1148A unknown Het
Mak C A 13: 41,032,544 E549D probably benign Het
Marf1 G T 16: 14,132,429 S1001Y probably damaging Het
Mcoln1 G A 8: 3,511,787 V446I probably damaging Het
Meig1 T C 2: 3,409,253 N70S probably benign Het
Mfsd14a G A 3: 116,647,830 T108I probably damaging Het
Mocs1 G A 17: 49,454,358 M493I probably damaging Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Myh6 A T 14: 54,953,794 D863E probably benign Het
Myom2 T A 8: 15,084,555 Y453N probably damaging Het
Nhlh1 A G 1: 172,053,957 I114T probably damaging Het
Olfr131 G T 17: 38,082,180 P266Q probably damaging Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr508 C G 7: 108,630,777 P262A probably damaging Het
Olfr533 A C 7: 140,466,591 H130P probably benign Het
Olfr729 A T 14: 50,148,697 M59K probably damaging Het
Pclo T C 5: 14,714,295 S976P probably benign Het
Pde3a G A 6: 141,483,914 E734K possibly damaging Het
Pdzd2 A T 15: 12,375,793 S1419T probably benign Het
Pdzd8 T A 19: 59,300,421 Y849F probably damaging Het
Phldb3 A G 7: 24,612,645 E128G probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Ppp1r35 T C 5: 137,780,005 M254T probably benign Het
Ppp3ca G T 3: 136,890,450 R292M possibly damaging Het
Ptk7 T A 17: 46,579,617 T430S probably benign Het
Rbfox1 A G 16: 7,294,082 T211A possibly damaging Het
Rbpjl A G 2: 164,414,423 D443G possibly damaging Het
Rcc1 A G 4: 132,338,049 probably null Het
Rimbp2 G T 5: 128,788,165 S706R probably damaging Het
Rsph10b G C 5: 143,961,256 E96D probably benign Het
Scn10a A T 9: 119,609,448 I1784K probably benign Het
Sfxn2 A G 19: 46,591,546 probably null Het
Slamf6 T A 1: 171,938,008 L233Q probably damaging Het
Slc17a5 A T 9: 78,577,173 Y102N probably damaging Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Smg7 G A 1: 152,840,313 T1057I possibly damaging Het
Speer2 T A 16: 69,860,597 T53S possibly damaging Het
Srm A C 4: 148,592,491 I100L probably benign Het
Stoml3 A C 3: 53,507,587 N267H probably damaging Het
Thsd7a A C 6: 12,379,633 C931G probably damaging Het
Tlr11 A G 14: 50,360,682 I42V probably benign Het
Tmigd1 T C 11: 76,910,173 V162A probably benign Het
Tmx3 A G 18: 90,510,381 probably null Het
Topors T A 4: 40,262,790 R165W possibly damaging Het
Ttc17 A T 2: 94,366,642 S453R possibly damaging Het
Vmn1r49 G T 6: 90,072,459 T187N probably damaging Het
Zbtb49 A T 5: 38,214,120 V139E possibly damaging Het
Zfp11 T C 5: 129,657,152 H415R probably damaging Het
Zfp677 A T 17: 21,397,708 K342N probably benign Het
Zfp979 A C 4: 147,613,458 C265G possibly damaging Het
Zfpl1 T C 19: 6,084,429 R9G probably damaging Het
Zkscan8 A T 13: 21,520,589 C321* probably null Het
Other mutations in Ptrh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ptrh1 APN 2 32776341 unclassified probably null
IGL02123:Ptrh1 APN 2 32776814 unclassified probably benign
R2484:Ptrh1 UTSW 2 32777171 missense probably benign
R4948:Ptrh1 UTSW 2 32776545 unclassified probably benign
R5332:Ptrh1 UTSW 2 32776746 missense probably damaging 0.96
R5449:Ptrh1 UTSW 2 32776346 missense probably damaging 1.00
R6213:Ptrh1 UTSW 2 32776745 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGGTGAGGCTCTTATGTGC -3'
(R):5'- CAGTGGCCTGATCCATCAATG -3'

Sequencing Primer
(F):5'- AGGGATGCTGGCCTCTG -3'
(R):5'- TCCTCCGGGGAGAAACAG -3'
Posted On2014-10-01