Incidental Mutation 'R2155:Ppp3ca'
ID234692
Institutional Source Beutler Lab
Gene Symbol Ppp3ca
Ensembl Gene ENSMUSG00000028161
Gene Nameprotein phosphatase 3, catalytic subunit, alpha isoform
SynonymsCaln, PP2BA alpha, 2900074D19Rik, PP2B alpha 1, Calna, CnA, CN
MMRRC Submission 040158-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2155 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location136670124-136937727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136890450 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 292 (R292M)
Ref Sequence ENSEMBL: ENSMUSP00000071040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056758] [ENSMUST00000070198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056758
AA Change: R292M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053101
Gene: ENSMUSG00000028161
AA Change: R292M

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 507 519 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070198
AA Change: R292M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071040
Gene: ENSMUSG00000028161
AA Change: R292M

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 497 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196603
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation and abnormal mossy fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A G 16: 17,121,396 L41P probably damaging Het
Aff4 C T 11: 53,399,619 L469F probably damaging Het
AI182371 G A 2: 35,085,354 H288Y probably benign Het
AK157302 A T 13: 21,495,657 K118* probably null Het
Arhgef2 G A 3: 88,636,044 R454Q probably damaging Het
Asb17 C T 3: 153,844,685 T118M probably damaging Het
Atp7b A G 8: 22,013,584 V718A possibly damaging Het
BC003331 A G 1: 150,382,335 V183A possibly damaging Het
Cdca2 A G 14: 67,714,838 L28S probably damaging Het
Cdh7 G T 1: 110,048,864 L86F probably damaging Het
Cela2a A T 4: 141,818,039 probably null Het
Cers3 T A 7: 66,783,414 Y160N probably damaging Het
Chmp2b A G 16: 65,546,991 V56A probably benign Het
Cryl1 A G 14: 57,398,423 V9A unknown Het
Dmbt1 A T 7: 131,097,575 H978L possibly damaging Het
Dnm1 C T 2: 32,314,937 V673M probably damaging Het
Dtx4 T A 19: 12,485,282 K378* probably null Het
Extl1 A T 4: 134,363,180 M328K possibly damaging Het
Fcgbp T C 7: 28,107,203 S2199P probably benign Het
Glis3 G T 19: 28,531,302 N427K probably benign Het
Gm6614 T C 6: 141,980,944 D552G probably damaging Het
Gm884 T C 11: 103,620,459 T228A unknown Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hesx1 A G 14: 27,001,477 E88G probably benign Het
Hmcn2 A T 2: 31,460,349 Q5086L possibly damaging Het
Ier3 A G 17: 35,822,209 T128A probably benign Het
Igsf10 G T 3: 59,331,680 T360K probably damaging Het
Ilkap A C 1: 91,384,623 C2G possibly damaging Het
Itih1 A G 14: 30,938,071 F231S probably damaging Het
Jrkl A T 9: 13,244,908 Y249* probably null Het
Kat6a AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 8: 22,935,647 probably benign Het
Katnal2 A T 18: 77,010,941 S184R probably benign Het
Kcnh5 T A 12: 74,898,456 probably null Het
Kcnj11 G T 7: 46,099,357 L181I probably damaging Het
Klhl2 T C 8: 64,749,770 T465A probably benign Het
Krt90 T A 15: 101,562,611 Y72F probably benign Het
Lig4 G A 8: 9,972,766 T338I probably benign Het
Magel2 T C 7: 62,380,792 V1148A unknown Het
Mak C A 13: 41,032,544 E549D probably benign Het
Marf1 G T 16: 14,132,429 S1001Y probably damaging Het
Mcoln1 G A 8: 3,511,787 V446I probably damaging Het
Meig1 T C 2: 3,409,253 N70S probably benign Het
Mfsd14a G A 3: 116,647,830 T108I probably damaging Het
Mocs1 G A 17: 49,454,358 M493I probably damaging Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Myh6 A T 14: 54,953,794 D863E probably benign Het
Myom2 T A 8: 15,084,555 Y453N probably damaging Het
Nhlh1 A G 1: 172,053,957 I114T probably damaging Het
Olfr131 G T 17: 38,082,180 P266Q probably damaging Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr508 C G 7: 108,630,777 P262A probably damaging Het
Olfr533 A C 7: 140,466,591 H130P probably benign Het
Olfr729 A T 14: 50,148,697 M59K probably damaging Het
Pclo T C 5: 14,714,295 S976P probably benign Het
Pde3a G A 6: 141,483,914 E734K possibly damaging Het
Pdzd2 A T 15: 12,375,793 S1419T probably benign Het
Pdzd8 T A 19: 59,300,421 Y849F probably damaging Het
Phldb3 A G 7: 24,612,645 E128G probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Ppp1r35 T C 5: 137,780,005 M254T probably benign Het
Ptk7 T A 17: 46,579,617 T430S probably benign Het
Ptrh1 T A 2: 32,777,028 N144K possibly damaging Het
Rbfox1 A G 16: 7,294,082 T211A possibly damaging Het
Rbpjl A G 2: 164,414,423 D443G possibly damaging Het
Rcc1 A G 4: 132,338,049 probably null Het
Rimbp2 G T 5: 128,788,165 S706R probably damaging Het
Rsph10b G C 5: 143,961,256 E96D probably benign Het
Scn10a A T 9: 119,609,448 I1784K probably benign Het
Sfxn2 A G 19: 46,591,546 probably null Het
Slamf6 T A 1: 171,938,008 L233Q probably damaging Het
Slc17a5 A T 9: 78,577,173 Y102N probably damaging Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Smg7 G A 1: 152,840,313 T1057I possibly damaging Het
Speer2 T A 16: 69,860,597 T53S possibly damaging Het
Srm A C 4: 148,592,491 I100L probably benign Het
Stoml3 A C 3: 53,507,587 N267H probably damaging Het
Thsd7a A C 6: 12,379,633 C931G probably damaging Het
Tlr11 A G 14: 50,360,682 I42V probably benign Het
Tmigd1 T C 11: 76,910,173 V162A probably benign Het
Tmx3 A G 18: 90,510,381 probably null Het
Topors T A 4: 40,262,790 R165W possibly damaging Het
Ttc17 A T 2: 94,366,642 S453R possibly damaging Het
Vmn1r49 G T 6: 90,072,459 T187N probably damaging Het
Zbtb49 A T 5: 38,214,120 V139E possibly damaging Het
Zfp11 T C 5: 129,657,152 H415R probably damaging Het
Zfp677 A T 17: 21,397,708 K342N probably benign Het
Zfp979 A C 4: 147,613,458 C265G possibly damaging Het
Zfpl1 T C 19: 6,084,429 R9G probably damaging Het
Zkscan8 A T 13: 21,520,589 C321* probably null Het
Other mutations in Ppp3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp3ca APN 3 136935181 missense probably benign 0.01
IGL01405:Ppp3ca APN 3 136868721 missense probably benign 0.33
IGL02061:Ppp3ca APN 3 136797863 missense probably benign
IGL02285:Ppp3ca APN 3 136928626 splice site probably benign
IGL02472:Ppp3ca APN 3 136921862 missense possibly damaging 0.57
IGL02706:Ppp3ca APN 3 136905318 missense possibly damaging 0.84
IGL02894:Ppp3ca APN 3 136797812 missense probably damaging 1.00
R0325:Ppp3ca UTSW 3 136935139 missense probably benign 0.15
R1072:Ppp3ca UTSW 3 136935127 missense probably benign
R1427:Ppp3ca UTSW 3 136921914 missense probably damaging 1.00
R1524:Ppp3ca UTSW 3 136797818 missense probably benign
R1568:Ppp3ca UTSW 3 136928544 missense probably benign 0.00
R1754:Ppp3ca UTSW 3 136881448 missense probably benign 0.20
R1800:Ppp3ca UTSW 3 136935031 missense probably damaging 0.98
R1844:Ppp3ca UTSW 3 136921911 missense probably benign 0.08
R1878:Ppp3ca UTSW 3 136797878 missense probably benign 0.03
R2160:Ppp3ca UTSW 3 136877630 missense probably damaging 1.00
R2220:Ppp3ca UTSW 3 136797924 missense probably damaging 1.00
R2331:Ppp3ca UTSW 3 136797819 missense probably benign
R3052:Ppp3ca UTSW 3 136797844 missense probably benign 0.00
R3500:Ppp3ca UTSW 3 136881512 missense probably benign 0.00
R4764:Ppp3ca UTSW 3 136890489 missense probably damaging 0.99
R4974:Ppp3ca UTSW 3 136935049 missense possibly damaging 0.60
R5952:Ppp3ca UTSW 3 136928571 missense probably benign 0.08
R6051:Ppp3ca UTSW 3 136876122 missense probably damaging 1.00
R6395:Ppp3ca UTSW 3 136877770 missense possibly damaging 0.47
R6975:Ppp3ca UTSW 3 136905301 missense probably damaging 1.00
R7121:Ppp3ca UTSW 3 136868626 missense probably damaging 1.00
R7720:Ppp3ca UTSW 3 136890489 missense probably damaging 1.00
R7773:Ppp3ca UTSW 3 136890461 missense probably benign
R7828:Ppp3ca UTSW 3 136797774 missense probably damaging 1.00
R7830:Ppp3ca UTSW 3 136868720 missense probably damaging 1.00
R8126:Ppp3ca UTSW 3 136903191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGACCGGTGTGATTCTAGGT -3'
(R):5'- TTTGAACCCCTTTCTATAATGGATTG -3'

Sequencing Primer
(F):5'- ACCGGTGTGATTCTAGGTTAGCATTC -3'
(R):5'- CATACAATAGAGGACTTCCGGGTCTG -3'
Posted On2014-10-01