Mutagenetix > Incidental Mutations

Incidental Mutation 'R0196:Msh6'

23471

Institutional Source

Beutler Lab

Gene Symbol

Msh6

Ensembl Gene

ENSMUSG00000005370

Gene Name

mutS homolog 6

Synonyms

GTBP, Gtmbp, Msh6

MMRRC Submission

038455-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87975050-87990883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 87980360 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 143 (V143I)

Ref Sequence

ENSEMBL: ENSMUSP00000005503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005503]

AlphaFold

P54276

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005503
AA Change: V143I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: V143I

Domain	Start	End	E-Value	Type
low complexity region	23	46	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
PWWP	90	152	9.01e-30	SMART
low complexity region	198	212	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
low complexity region	273	291	N/A	INTRINSIC
low complexity region	373	389	N/A	INTRINSIC
Pfam:MutS_I	406	525	4.7e-35	PFAM
Pfam:MutS_II	536	700	1.4e-10	PFAM
MUTSd	750	1100	4.56e-86	SMART
MUTSac	1125	1319	1.68e-116	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Msh6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Msh6	APN	17	87985479	missense	probably benign
IGL01834:Msh6	APN	17	87985712	missense	probably damaging	1.00
IGL01904:Msh6	APN	17	87984732	missense	probably benign
IGL01957:Msh6	APN	17	87985091	missense	possibly damaging	0.73
IGL02117:Msh6	APN	17	87990806	unclassified	probably benign
IGL02234:Msh6	APN	17	87986801	missense	probably damaging	1.00
IGL02512:Msh6	APN	17	87984732	missense	probably benign
IGL02651:Msh6	APN	17	87989515	missense	probably damaging	1.00
IGL03381:Msh6	APN	17	87985109	missense	probably damaging	1.00
medea	UTSW	17	87980223	nonsense	probably null
medusa	UTSW	17	87988463	unclassified	probably benign
PIT4449001:Msh6	UTSW	17	87986188	missense	probably damaging	0.96
R0324:Msh6	UTSW	17	87986620	nonsense	probably null
R0492:Msh6	UTSW	17	87975251	missense	probably benign
R0711:Msh6	UTSW	17	87986684	missense	probably damaging	1.00
R1065:Msh6	UTSW	17	87988463	unclassified	probably benign
R1454:Msh6	UTSW	17	87984758	missense	probably benign	0.00
R1740:Msh6	UTSW	17	87985722	missense	possibly damaging	0.72
R1770:Msh6	UTSW	17	87980223	nonsense	probably null
R1771:Msh6	UTSW	17	87984522	missense	probably benign	0.17
R1919:Msh6	UTSW	17	87985125	missense	probably benign	0.01
R1926:Msh6	UTSW	17	87986225	missense	probably benign
R2026:Msh6	UTSW	17	87990343	missense	probably damaging	1.00
R2095:Msh6	UTSW	17	87988233	missense	possibly damaging	0.93
R2097:Msh6	UTSW	17	87985416	missense	probably benign	0.00
R2149:Msh6	UTSW	17	87986088	missense	probably damaging	1.00
R2156:Msh6	UTSW	17	87986140	nonsense	probably null
R2167:Msh6	UTSW	17	87989483	missense	probably damaging	1.00
R2382:Msh6	UTSW	17	87984731	missense	probably benign
R3005:Msh6	UTSW	17	87988285	missense	probably benign	0.34
R3160:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3774:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R3775:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R4350:Msh6	UTSW	17	87984584	missense	probably damaging	1.00
R4424:Msh6	UTSW	17	87990789	nonsense	probably null
R4499:Msh6	UTSW	17	87980269	missense	probably damaging	1.00
R4667:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4668:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4669:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4849:Msh6	UTSW	17	87983519	missense	possibly damaging	0.94
R5137:Msh6	UTSW	17	87980288	missense	possibly damaging	0.83
R5472:Msh6	UTSW	17	87984561	missense	possibly damaging	0.81
R5594:Msh6	UTSW	17	87986069	missense	probably benign	0.00
R5607:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5608:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5660:Msh6	UTSW	17	87984719	missense	possibly damaging	0.94
R6243:Msh6	UTSW	17	87983571	missense	possibly damaging	0.69
R6279:Msh6	UTSW	17	87980249	missense	probably damaging	1.00
R6357:Msh6	UTSW	17	87984460	nonsense	probably null
R6399:Msh6	UTSW	17	87986891	missense	probably damaging	1.00
R6453:Msh6	UTSW	17	87985739	missense	probably damaging	1.00
R6646:Msh6	UTSW	17	87986442	missense	possibly damaging	0.80
R7404:Msh6	UTSW	17	87975120
R7837:Msh6	UTSW	17	87984666	missense	probably damaging	1.00
R8004:Msh6	UTSW	17	87986787	missense	probably damaging	1.00
R8296:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8326:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8377:Msh6	UTSW	17	87985170	missense	probably damaging	1.00
R8715:Msh6	UTSW	17	87985767	missense	probably benign
X0026:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
X0026:Msh6	UTSW	17	87990614	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTTGCCAGAAGCCTCCAAAGG -3'
(R):5'- TGCTCTGATGTGAAACGCAGCTC -3'

Sequencing Primer
(F):5'- TAATTGCCATTGAGGTAAGGTAGCC -3'
(R):5'- CATAGGTCACAATTTTGGAGGC -3'

Posted On

2013-04-16