Incidental Mutation 'R0196:Hars2'
ID23472
Institutional Source Beutler Lab
Gene Symbol Hars2
Ensembl Gene ENSMUSG00000019143
Gene Namehistidyl-tRNA synthetase 2
SynonymsHarsl, HARSR, HO3
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R0196 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36783008-36792562 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 36789204 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 291 (Q291*)
Ref Sequence ENSEMBL: ENSMUSP00000117231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001419] [ENSMUST00000019287] [ENSMUST00000152954]
Predicted Effect probably benign
Transcript: ENSMUST00000001419
SMART Domains Protein: ENSMUSP00000001419
Gene: ENSMUSG00000001383

DomainStartEndE-ValueType
ZnF_U1 77 111 2.41e-11 SMART
ZnF_C2H2 80 104 5.48e0 SMART
coiled coil region 118 180 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000019287
AA Change: Q291*
SMART Domains Protein: ENSMUSP00000019287
Gene: ENSMUSG00000019143
AA Change: Q291*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 313 1.3e-23 PFAM
Pfam:tRNA-synt_2b 72 234 2.8e-21 PFAM
Pfam:HGTP_anticodon2 324 424 2.7e-8 PFAM
Pfam:HGTP_anticodon 329 420 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145876
Predicted Effect probably null
Transcript: ENSMUST00000152954
AA Change: Q291*
SMART Domains Protein: ENSMUSP00000117231
Gene: ENSMUSG00000019143
AA Change: Q291*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 389 1e-38 PFAM
Pfam:HGTP_anticodon 410 501 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155842
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of histidine to tRNA molecules. Mutations in a similar gene in human have been associated with Perrault syndrome 2 (PRLTS2). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Hars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Hars2 APN 18 36785936 missense probably damaging 1.00
IGL00955:Hars2 APN 18 36789357 splice site probably benign
IGL01570:Hars2 APN 18 36787592 missense probably benign 0.04
IGL01618:Hars2 APN 18 36789577 nonsense probably null
IGL02165:Hars2 APN 18 36783394 start codon destroyed probably null 1.00
IGL02290:Hars2 APN 18 36785626 missense possibly damaging 0.56
IGL02685:Hars2 APN 18 36791118 missense probably benign 0.18
IGL02805:Hars2 APN 18 36787577 nonsense probably null
IGL02971:Hars2 APN 18 36786178 missense probably damaging 1.00
IGL03373:Hars2 APN 18 36785945 missense probably damaging 0.99
R0543:Hars2 UTSW 18 36789424 missense probably damaging 1.00
R0549:Hars2 UTSW 18 36786208 critical splice donor site probably null
R0557:Hars2 UTSW 18 36791077 missense possibly damaging 0.94
R0893:Hars2 UTSW 18 36787595 missense possibly damaging 0.56
R1188:Hars2 UTSW 18 36787969 missense probably damaging 0.99
R1289:Hars2 UTSW 18 36783412 unclassified probably null
R1381:Hars2 UTSW 18 36789217 missense possibly damaging 0.68
R2401:Hars2 UTSW 18 36789523 missense possibly damaging 0.95
R4119:Hars2 UTSW 18 36790488 missense probably damaging 0.98
R4351:Hars2 UTSW 18 36786178 missense probably damaging 1.00
R4404:Hars2 UTSW 18 36785936 missense probably damaging 1.00
R5372:Hars2 UTSW 18 36790481 missense possibly damaging 0.93
R5629:Hars2 UTSW 18 36788666 nonsense probably null
R5886:Hars2 UTSW 18 36790097 intron probably benign
R7069:Hars2 UTSW 18 36787956 missense probably damaging 0.99
R7070:Hars2 UTSW 18 36791112 nonsense probably null
R7188:Hars2 UTSW 18 36790561 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGAGTTTAGCCTGGATAAAGGTTCCC -3'
(R):5'- ACCAGATTGTCATAGCGCCCAC -3'

Sequencing Primer
(F):5'- aaagtgggggcaggtgg -3'
(R):5'- GTATAATAGTCCAGGCCCCG -3'
Posted On2013-04-16