Mutagenetix > Incidental Mutations

Incidental Mutation 'R2155:Pdzd2'

234748

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

040158-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R2155 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12375793 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1419 (S1419T)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317]

Predicted Effect

probably benign
Transcript: ENSMUST00000075317
AA Change: S1419T

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: S1419T

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	G	16: 17,121,396	L41P	probably damaging	Het
Aff4	C	T	11: 53,399,619	L469F	probably damaging	Het
AI182371	G	A	2: 35,085,354	H288Y	probably benign	Het
AK157302	A	T	13: 21,495,657	K118*	probably null	Het
Arhgef2	G	A	3: 88,636,044	R454Q	probably damaging	Het
Asb17	C	T	3: 153,844,685	T118M	probably damaging	Het
Atp7b	A	G	8: 22,013,584	V718A	possibly damaging	Het
BC003331	A	G	1: 150,382,335	V183A	possibly damaging	Het
Cdca2	A	G	14: 67,714,838	L28S	probably damaging	Het
Cdh7	G	T	1: 110,048,864	L86F	probably damaging	Het
Cela2a	A	T	4: 141,818,039		probably null	Het
Cers3	T	A	7: 66,783,414	Y160N	probably damaging	Het
Chmp2b	A	G	16: 65,546,991	V56A	probably benign	Het
Cryl1	A	G	14: 57,398,423	V9A	unknown	Het
Dmbt1	A	T	7: 131,097,575	H978L	possibly damaging	Het
Dnm1	C	T	2: 32,314,937	V673M	probably damaging	Het
Dtx4	T	A	19: 12,485,282	K378*	probably null	Het
Extl1	A	T	4: 134,363,180	M328K	possibly damaging	Het
Fcgbp	T	C	7: 28,107,203	S2199P	probably benign	Het
Glis3	G	T	19: 28,531,302	N427K	probably benign	Het
Gm6614	T	C	6: 141,980,944	D552G	probably damaging	Het
Gm884	T	C	11: 103,620,459	T228A	unknown	Het
Hdac7	T	C	15: 97,794,063	K810E	probably benign	Het
Hesx1	A	G	14: 27,001,477	E88G	probably benign	Het
Hmcn2	A	T	2: 31,460,349	Q5086L	possibly damaging	Het
Ier3	A	G	17: 35,822,209	T128A	probably benign	Het
Igsf10	G	T	3: 59,331,680	T360K	probably damaging	Het
Ilkap	A	C	1: 91,384,623	C2G	possibly damaging	Het
Itih1	A	G	14: 30,938,071	F231S	probably damaging	Het
Jrkl	A	T	9: 13,244,908	Y249*	probably null	Het
Kat6a	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	8: 22,935,647		probably benign	Het
Katnal2	A	T	18: 77,010,941	S184R	probably benign	Het
Kcnh5	T	A	12: 74,898,456		probably null	Het
Kcnj11	G	T	7: 46,099,357	L181I	probably damaging	Het
Klhl2	T	C	8: 64,749,770	T465A	probably benign	Het
Krt90	T	A	15: 101,562,611	Y72F	probably benign	Het
Lig4	G	A	8: 9,972,766	T338I	probably benign	Het
Magel2	T	C	7: 62,380,792	V1148A	unknown	Het
Mak	C	A	13: 41,032,544	E549D	probably benign	Het
Marf1	G	T	16: 14,132,429	S1001Y	probably damaging	Het
Mcoln1	G	A	8: 3,511,787	V446I	probably damaging	Het
Meig1	T	C	2: 3,409,253	N70S	probably benign	Het
Mfsd14a	G	A	3: 116,647,830	T108I	probably damaging	Het
Mocs1	G	A	17: 49,454,358	M493I	probably damaging	Het
Mrpl11	C	A	19: 4,962,469	A26E	probably damaging	Het
Myh6	A	T	14: 54,953,794	D863E	probably benign	Het
Myom2	T	A	8: 15,084,555	Y453N	probably damaging	Het
Nhlh1	A	G	1: 172,053,957	I114T	probably damaging	Het
Olfr131	G	T	17: 38,082,180	P266Q	probably damaging	Het
Olfr181	G	T	16: 58,926,123	F149L	probably benign	Het
Olfr508	C	G	7: 108,630,777	P262A	probably damaging	Het
Olfr533	A	C	7: 140,466,591	H130P	probably benign	Het
Olfr729	A	T	14: 50,148,697	M59K	probably damaging	Het
Pclo	T	C	5: 14,714,295	S976P	probably benign	Het
Pde3a	G	A	6: 141,483,914	E734K	possibly damaging	Het
Pdzd8	T	A	19: 59,300,421	Y849F	probably damaging	Het
Phldb3	A	G	7: 24,612,645	E128G	probably damaging	Het
Polg	A	G	7: 79,461,720	I261T	possibly damaging	Het
Ppp1r35	T	C	5: 137,780,005	M254T	probably benign	Het
Ppp3ca	G	T	3: 136,890,450	R292M	possibly damaging	Het
Ptk7	T	A	17: 46,579,617	T430S	probably benign	Het
Ptrh1	T	A	2: 32,777,028	N144K	possibly damaging	Het
Rbfox1	A	G	16: 7,294,082	T211A	possibly damaging	Het
Rbpjl	A	G	2: 164,414,423	D443G	possibly damaging	Het
Rcc1	A	G	4: 132,338,049		probably null	Het
Rimbp2	G	T	5: 128,788,165	S706R	probably damaging	Het
Rsph10b	G	C	5: 143,961,256	E96D	probably benign	Het
Scn10a	A	T	9: 119,609,448	I1784K	probably benign	Het
Sfxn2	A	G	19: 46,591,546		probably null	Het
Slamf6	T	A	1: 171,938,008	L233Q	probably damaging	Het
Slc17a5	A	T	9: 78,577,173	Y102N	probably damaging	Het
Slc25a53	T	C	X: 136,983,467	T42A	probably damaging	Het
Smg7	G	A	1: 152,840,313	T1057I	possibly damaging	Het
Speer2	T	A	16: 69,860,597	T53S	possibly damaging	Het
Srm	A	C	4: 148,592,491	I100L	probably benign	Het
Stoml3	A	C	3: 53,507,587	N267H	probably damaging	Het
Thsd7a	A	C	6: 12,379,633	C931G	probably damaging	Het
Tlr11	A	G	14: 50,360,682	I42V	probably benign	Het
Tmigd1	T	C	11: 76,910,173	V162A	probably benign	Het
Tmx3	A	G	18: 90,510,381		probably null	Het
Topors	T	A	4: 40,262,790	R165W	possibly damaging	Het
Ttc17	A	T	2: 94,366,642	S453R	possibly damaging	Het
Vmn1r49	G	T	6: 90,072,459	T187N	probably damaging	Het
Zbtb49	A	T	5: 38,214,120	V139E	possibly damaging	Het
Zfp11	T	C	5: 129,657,152	H415R	probably damaging	Het
Zfp677	A	T	17: 21,397,708	K342N	probably benign	Het
Zfp979	A	C	4: 147,613,458	C265G	possibly damaging	Het
Zfpl1	T	C	19: 6,084,429	R9G	probably damaging	Het
Zkscan8	A	T	13: 21,520,589	C321*	probably null	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	unclassified	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGTGGAAACTGCTAAAATTTCTGG -3'
(R):5'- AGCTTGAAAGATAGGGCTCTGC -3'

Sequencing Primer
(F):5'- GAAAGTTTTTGTTCCCAGCCAACTG -3'
(R):5'- GCTCTGCTTGAAGAAACAGCGTC -3'

Posted On

2014-10-01