Incidental Mutation 'R2155:Pdzd2'
ID234748
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 040158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R2155 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12375793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1419 (S1419T)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect probably benign
Transcript: ENSMUST00000075317
AA Change: S1419T

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: S1419T

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A G 16: 17,121,396 L41P probably damaging Het
Aff4 C T 11: 53,399,619 L469F probably damaging Het
AI182371 G A 2: 35,085,354 H288Y probably benign Het
AK157302 A T 13: 21,495,657 K118* probably null Het
Arhgef2 G A 3: 88,636,044 R454Q probably damaging Het
Asb17 C T 3: 153,844,685 T118M probably damaging Het
Atp7b A G 8: 22,013,584 V718A possibly damaging Het
BC003331 A G 1: 150,382,335 V183A possibly damaging Het
Cdca2 A G 14: 67,714,838 L28S probably damaging Het
Cdh7 G T 1: 110,048,864 L86F probably damaging Het
Cela2a A T 4: 141,818,039 probably null Het
Cers3 T A 7: 66,783,414 Y160N probably damaging Het
Chmp2b A G 16: 65,546,991 V56A probably benign Het
Cryl1 A G 14: 57,398,423 V9A unknown Het
Dmbt1 A T 7: 131,097,575 H978L possibly damaging Het
Dnm1 C T 2: 32,314,937 V673M probably damaging Het
Dtx4 T A 19: 12,485,282 K378* probably null Het
Extl1 A T 4: 134,363,180 M328K possibly damaging Het
Fcgbp T C 7: 28,107,203 S2199P probably benign Het
Glis3 G T 19: 28,531,302 N427K probably benign Het
Gm6614 T C 6: 141,980,944 D552G probably damaging Het
Gm884 T C 11: 103,620,459 T228A unknown Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hesx1 A G 14: 27,001,477 E88G probably benign Het
Hmcn2 A T 2: 31,460,349 Q5086L possibly damaging Het
Ier3 A G 17: 35,822,209 T128A probably benign Het
Igsf10 G T 3: 59,331,680 T360K probably damaging Het
Ilkap A C 1: 91,384,623 C2G possibly damaging Het
Itih1 A G 14: 30,938,071 F231S probably damaging Het
Jrkl A T 9: 13,244,908 Y249* probably null Het
Kat6a AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 8: 22,935,647 probably benign Het
Katnal2 A T 18: 77,010,941 S184R probably benign Het
Kcnh5 T A 12: 74,898,456 probably null Het
Kcnj11 G T 7: 46,099,357 L181I probably damaging Het
Klhl2 T C 8: 64,749,770 T465A probably benign Het
Krt90 T A 15: 101,562,611 Y72F probably benign Het
Lig4 G A 8: 9,972,766 T338I probably benign Het
Magel2 T C 7: 62,380,792 V1148A unknown Het
Mak C A 13: 41,032,544 E549D probably benign Het
Marf1 G T 16: 14,132,429 S1001Y probably damaging Het
Mcoln1 G A 8: 3,511,787 V446I probably damaging Het
Meig1 T C 2: 3,409,253 N70S probably benign Het
Mfsd14a G A 3: 116,647,830 T108I probably damaging Het
Mocs1 G A 17: 49,454,358 M493I probably damaging Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Myh6 A T 14: 54,953,794 D863E probably benign Het
Myom2 T A 8: 15,084,555 Y453N probably damaging Het
Nhlh1 A G 1: 172,053,957 I114T probably damaging Het
Olfr131 G T 17: 38,082,180 P266Q probably damaging Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr508 C G 7: 108,630,777 P262A probably damaging Het
Olfr533 A C 7: 140,466,591 H130P probably benign Het
Olfr729 A T 14: 50,148,697 M59K probably damaging Het
Pclo T C 5: 14,714,295 S976P probably benign Het
Pde3a G A 6: 141,483,914 E734K possibly damaging Het
Pdzd8 T A 19: 59,300,421 Y849F probably damaging Het
Phldb3 A G 7: 24,612,645 E128G probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Ppp1r35 T C 5: 137,780,005 M254T probably benign Het
Ppp3ca G T 3: 136,890,450 R292M possibly damaging Het
Ptk7 T A 17: 46,579,617 T430S probably benign Het
Ptrh1 T A 2: 32,777,028 N144K possibly damaging Het
Rbfox1 A G 16: 7,294,082 T211A possibly damaging Het
Rbpjl A G 2: 164,414,423 D443G possibly damaging Het
Rcc1 A G 4: 132,338,049 probably null Het
Rimbp2 G T 5: 128,788,165 S706R probably damaging Het
Rsph10b G C 5: 143,961,256 E96D probably benign Het
Scn10a A T 9: 119,609,448 I1784K probably benign Het
Sfxn2 A G 19: 46,591,546 probably null Het
Slamf6 T A 1: 171,938,008 L233Q probably damaging Het
Slc17a5 A T 9: 78,577,173 Y102N probably damaging Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Smg7 G A 1: 152,840,313 T1057I possibly damaging Het
Speer2 T A 16: 69,860,597 T53S possibly damaging Het
Srm A C 4: 148,592,491 I100L probably benign Het
Stoml3 A C 3: 53,507,587 N267H probably damaging Het
Thsd7a A C 6: 12,379,633 C931G probably damaging Het
Tlr11 A G 14: 50,360,682 I42V probably benign Het
Tmigd1 T C 11: 76,910,173 V162A probably benign Het
Tmx3 A G 18: 90,510,381 probably null Het
Topors T A 4: 40,262,790 R165W possibly damaging Het
Ttc17 A T 2: 94,366,642 S453R possibly damaging Het
Vmn1r49 G T 6: 90,072,459 T187N probably damaging Het
Zbtb49 A T 5: 38,214,120 V139E possibly damaging Het
Zfp11 T C 5: 129,657,152 H415R probably damaging Het
Zfp677 A T 17: 21,397,708 K342N probably benign Het
Zfp979 A C 4: 147,613,458 C265G possibly damaging Het
Zfpl1 T C 19: 6,084,429 R9G probably damaging Het
Zkscan8 A T 13: 21,520,589 C321* probably null Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTGGAAACTGCTAAAATTTCTGG -3'
(R):5'- AGCTTGAAAGATAGGGCTCTGC -3'

Sequencing Primer
(F):5'- GAAAGTTTTTGTTCCCAGCCAACTG -3'
(R):5'- GCTCTGCTTGAAGAAACAGCGTC -3'
Posted On2014-10-01