Incidental Mutation 'R2156:Pde4dip'
ID234792
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 040159-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2156 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97724218 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1125 (Q1125R)
Ref Sequence ENSEMBL: ENSMUSP00000131170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090750
AA Change: Q1125R

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: Q1125R

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168438
AA Change: Q1125R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: Q1125R

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,422,308 probably null Het
Acaa2 T C 18: 74,793,405 probably null Het
Adam7 T C 14: 68,511,343 Q485R probably benign Het
Adcy4 T G 14: 55,769,170 T1069P probably benign Het
Arsj T C 3: 126,438,688 L361P probably damaging Het
Birc2 A C 9: 7,826,938 L349R probably damaging Het
C1qa T C 4: 136,896,416 Y159C probably damaging Het
Cdh13 A G 8: 119,236,964 K428E probably damaging Het
Cenpe T C 3: 135,247,474 M1563T probably benign Het
Col10a1 T C 10: 34,395,700 V556A probably benign Het
Creg2 G A 1: 39,623,170 L265F probably damaging Het
Cyp1a2 T A 9: 57,682,150 D127V probably damaging Het
Cyp3a44 A T 5: 145,803,670 Y53* probably null Het
Cyth1 C T 11: 118,182,808 R233Q probably damaging Het
Dnmbp G A 19: 43,901,907 H474Y possibly damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ercc2 G A 7: 19,386,792 R206H possibly damaging Het
Evx2 T A 2: 74,656,016 H343L probably damaging Het
Fcrls T A 3: 87,257,341 I293F probably benign Het
Gcnt4 A G 13: 96,946,466 E90G probably damaging Het
Gid8 T G 2: 180,716,958 C139G probably benign Het
Gm11938 C A 11: 99,603,107 C54F probably damaging Het
Gm3336 G A 8: 70,721,860 V158I probably benign Het
Gm5415 T A 1: 32,546,047 M261L probably benign Het
Gucy1b1 T C 3: 82,061,020 N60D probably benign Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hsp90ab1 A G 17: 45,569,703 F361L possibly damaging Het
Igf2bp3 A T 6: 49,108,924 probably null Het
Inpp4b T A 8: 82,048,489 I772N probably damaging Het
Iqca A G 1: 90,089,516 L390P possibly damaging Het
Itgb2 C T 10: 77,560,248 R586W probably benign Het
Itih1 A G 14: 30,933,475 S588P possibly damaging Het
Iyd T A 10: 3,547,166 probably null Het
Kl A G 5: 150,988,960 K725E probably benign Het
Layn T A 9: 51,057,397 M349L probably benign Het
Map3k5 T C 10: 20,024,937 Y286H probably damaging Het
Med4 C T 14: 73,518,032 probably benign Het
Mfn1 T A 3: 32,534,251 N42K possibly damaging Het
Mindy2 T C 9: 70,656,592 D152G probably benign Het
Mrc2 A G 11: 105,347,856 probably null Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Msh6 G A 17: 87,986,140 W774* probably null Het
Mtch1 A T 17: 29,342,867 V121E probably damaging Het
Mtg2 G T 2: 180,084,130 E178* probably null Het
Nbas A T 12: 13,441,509 N1461Y probably damaging Het
Ndfip2 A G 14: 105,287,770 T65A probably benign Het
Ninl G T 2: 150,944,583 Q1146K probably damaging Het
Notch1 T C 2: 26,460,861 D2089G possibly damaging Het
Notch3 C T 17: 32,147,844 V906M probably damaging Het
Olfr606 A G 7: 103,452,164 I276V probably benign Het
Olfr711 A G 7: 106,971,568 Y259H probably damaging Het
Osmr A T 15: 6,844,410 Y169N probably benign Het
Ovgp1 T C 3: 105,977,717 V124A possibly damaging Het
P2rx1 T C 11: 73,014,113 M369T probably benign Het
Podn A T 4: 108,021,695 V180E probably damaging Het
Pold1 A T 7: 44,539,118 V475E probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Satb1 G T 17: 51,740,410 Q595K probably benign Het
Scaf8 T A 17: 3,164,132 probably null Het
Serpinb3a C T 1: 107,047,472 probably null Het
Slc22a26 T C 19: 7,802,115 D112G probably damaging Het
Slc25a23 A G 17: 57,045,562 F441L probably benign Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Slc6a15 T C 10: 103,393,408 Y103H probably damaging Het
Slx4 A G 16: 3,986,359 S864P probably benign Het
Snap91 T C 9: 86,825,077 E220G probably damaging Het
Spam1 T C 6: 24,796,268 F73L probably damaging Het
Sphkap C T 1: 83,277,989 V393M probably benign Het
Spred2 T C 11: 20,021,241 Y370H probably damaging Het
Sqle T C 15: 59,323,729 probably null Het
Srrm2 A G 17: 23,818,263 T1390A probably benign Het
Tas1r2 A G 4: 139,669,041 R564G possibly damaging Het
Tbl2 G T 5: 135,156,520 probably null Het
Tcof1 T C 18: 60,831,829 D606G possibly damaging Het
Tdpoz3 T A 3: 93,826,780 L254H probably damaging Het
Trpm1 A T 7: 64,234,988 I806F probably damaging Het
Ttc22 A G 4: 106,639,040 D429G probably benign Het
Ube2o C A 11: 116,581,146 G90C probably damaging Het
Usp34 T A 11: 23,382,602 F1110I probably damaging Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Vps35 A G 8: 85,286,500 V116A probably benign Het
Wdfy3 A G 5: 101,898,425 probably null Het
Zeb2 T C 2: 44,988,809 K1138E probably benign Het
Zfp513 G A 5: 31,200,522 T169I probably benign Het
Zfp629 T C 7: 127,612,379 D86G probably benign Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCTGTGTTGTGGATGACC -3'
(R):5'- AGGAGCTGCCCTTTCTTGTG -3'

Sequencing Primer
(F):5'- ACCAATGCCTTGAGTGCAG -3'
(R):5'- GTGATCTTGGGTGAACTCCAG -3'
Posted On2014-10-01