Incidental Mutation 'R2156:Igf2bp3'
ID234811
Institutional Source Beutler Lab
Gene Symbol Igf2bp3
Ensembl Gene ENSMUSG00000029814
Gene Nameinsulin-like growth factor 2 mRNA binding protein 3
SynonymsIMP3, 2610101N11Rik, Koc13
MMRRC Submission 040159-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2156 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location49085223-49214957 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 49108924 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031838]
Predicted Effect probably null
Transcript: ENSMUST00000031838
SMART Domains Protein: ENSMUSP00000031838
Gene: ENSMUSG00000029814

DomainStartEndE-ValueType
RRM 3 71 1.96e-8 SMART
RRM 82 152 3.92e-8 SMART
low complexity region 164 182 N/A INTRINSIC
KH 194 265 3.01e-11 SMART
KH 275 348 1.51e-16 SMART
low complexity region 377 398 N/A INTRINSIC
KH 404 475 2.16e-12 SMART
KH 486 558 1.66e-13 SMART
low complexity region 559 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203863
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is primarily found in the nucleolus, where it can bind to the 5' UTR of the insulin-like growth factor II leader 3 mRNA and may repress translation of insulin-like growth factor II during late development. The encoded protein contains several KH domains, which are important in RNA binding and are known to be involved in RNA synthesis and metabolism. A pseudogene exists on chromosome 7, and there are putative pseudogenes on other chromosomes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,422,308 probably null Het
Acaa2 T C 18: 74,793,405 probably null Het
Adam7 T C 14: 68,511,343 Q485R probably benign Het
Adcy4 T G 14: 55,769,170 T1069P probably benign Het
Arsj T C 3: 126,438,688 L361P probably damaging Het
Birc2 A C 9: 7,826,938 L349R probably damaging Het
C1qa T C 4: 136,896,416 Y159C probably damaging Het
Cdh13 A G 8: 119,236,964 K428E probably damaging Het
Cenpe T C 3: 135,247,474 M1563T probably benign Het
Col10a1 T C 10: 34,395,700 V556A probably benign Het
Creg2 G A 1: 39,623,170 L265F probably damaging Het
Cyp1a2 T A 9: 57,682,150 D127V probably damaging Het
Cyp3a44 A T 5: 145,803,670 Y53* probably null Het
Cyth1 C T 11: 118,182,808 R233Q probably damaging Het
Dnmbp G A 19: 43,901,907 H474Y possibly damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ercc2 G A 7: 19,386,792 R206H possibly damaging Het
Evx2 T A 2: 74,656,016 H343L probably damaging Het
Fcrls T A 3: 87,257,341 I293F probably benign Het
Gcnt4 A G 13: 96,946,466 E90G probably damaging Het
Gid8 T G 2: 180,716,958 C139G probably benign Het
Gm11938 C A 11: 99,603,107 C54F probably damaging Het
Gm3336 G A 8: 70,721,860 V158I probably benign Het
Gm5415 T A 1: 32,546,047 M261L probably benign Het
Gucy1b1 T C 3: 82,061,020 N60D probably benign Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hsp90ab1 A G 17: 45,569,703 F361L possibly damaging Het
Inpp4b T A 8: 82,048,489 I772N probably damaging Het
Iqca A G 1: 90,089,516 L390P possibly damaging Het
Itgb2 C T 10: 77,560,248 R586W probably benign Het
Itih1 A G 14: 30,933,475 S588P possibly damaging Het
Iyd T A 10: 3,547,166 probably null Het
Kl A G 5: 150,988,960 K725E probably benign Het
Layn T A 9: 51,057,397 M349L probably benign Het
Map3k5 T C 10: 20,024,937 Y286H probably damaging Het
Med4 C T 14: 73,518,032 probably benign Het
Mfn1 T A 3: 32,534,251 N42K possibly damaging Het
Mindy2 T C 9: 70,656,592 D152G probably benign Het
Mrc2 A G 11: 105,347,856 probably null Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Msh6 G A 17: 87,986,140 W774* probably null Het
Mtch1 A T 17: 29,342,867 V121E probably damaging Het
Mtg2 G T 2: 180,084,130 E178* probably null Het
Nbas A T 12: 13,441,509 N1461Y probably damaging Het
Ndfip2 A G 14: 105,287,770 T65A probably benign Het
Ninl G T 2: 150,944,583 Q1146K probably damaging Het
Notch1 T C 2: 26,460,861 D2089G possibly damaging Het
Notch3 C T 17: 32,147,844 V906M probably damaging Het
Olfr606 A G 7: 103,452,164 I276V probably benign Het
Olfr711 A G 7: 106,971,568 Y259H probably damaging Het
Osmr A T 15: 6,844,410 Y169N probably benign Het
Ovgp1 T C 3: 105,977,717 V124A possibly damaging Het
P2rx1 T C 11: 73,014,113 M369T probably benign Het
Pde4dip T C 3: 97,724,218 Q1125R probably damaging Het
Podn A T 4: 108,021,695 V180E probably damaging Het
Pold1 A T 7: 44,539,118 V475E probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Satb1 G T 17: 51,740,410 Q595K probably benign Het
Scaf8 T A 17: 3,164,132 probably null Het
Serpinb3a C T 1: 107,047,472 probably null Het
Slc22a26 T C 19: 7,802,115 D112G probably damaging Het
Slc25a23 A G 17: 57,045,562 F441L probably benign Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Slc6a15 T C 10: 103,393,408 Y103H probably damaging Het
Slx4 A G 16: 3,986,359 S864P probably benign Het
Snap91 T C 9: 86,825,077 E220G probably damaging Het
Spam1 T C 6: 24,796,268 F73L probably damaging Het
Sphkap C T 1: 83,277,989 V393M probably benign Het
Spred2 T C 11: 20,021,241 Y370H probably damaging Het
Sqle T C 15: 59,323,729 probably null Het
Srrm2 A G 17: 23,818,263 T1390A probably benign Het
Tas1r2 A G 4: 139,669,041 R564G possibly damaging Het
Tbl2 G T 5: 135,156,520 probably null Het
Tcof1 T C 18: 60,831,829 D606G possibly damaging Het
Tdpoz3 T A 3: 93,826,780 L254H probably damaging Het
Trpm1 A T 7: 64,234,988 I806F probably damaging Het
Ttc22 A G 4: 106,639,040 D429G probably benign Het
Ube2o C A 11: 116,581,146 G90C probably damaging Het
Usp34 T A 11: 23,382,602 F1110I probably damaging Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Vps35 A G 8: 85,286,500 V116A probably benign Het
Wdfy3 A G 5: 101,898,425 probably null Het
Zeb2 T C 2: 44,988,809 K1138E probably benign Het
Zfp513 G A 5: 31,200,522 T169I probably benign Het
Zfp629 T C 7: 127,612,379 D86G probably benign Het
Other mutations in Igf2bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Igf2bp3 APN 6 49088524 missense probably benign 0.02
IGL02473:Igf2bp3 APN 6 49094229 missense probably benign 0.03
IGL02957:Igf2bp3 APN 6 49087404 missense probably benign 0.28
bittie UTSW 6 49107428 missense possibly damaging 0.61
bump UTSW 6 49117150 critical splice donor site probably benign
PIT4131001:Igf2bp3 UTSW 6 49117150 critical splice donor site probably null
PIT4142001:Igf2bp3 UTSW 6 49117383 missense probably damaging 0.98
R0207:Igf2bp3 UTSW 6 49105617 missense probably benign 0.03
R0541:Igf2bp3 UTSW 6 49107467 splice site probably benign
R1710:Igf2bp3 UTSW 6 49105631 missense probably damaging 1.00
R1764:Igf2bp3 UTSW 6 49109046 missense probably damaging 1.00
R2207:Igf2bp3 UTSW 6 49088554 missense possibly damaging 0.92
R5638:Igf2bp3 UTSW 6 49087800 missense probably damaging 1.00
R5899:Igf2bp3 UTSW 6 49117150 critical splice donor site probably benign
R6108:Igf2bp3 UTSW 6 49117374 missense probably damaging 1.00
R6243:Igf2bp3 UTSW 6 49107428 missense possibly damaging 0.61
R6340:Igf2bp3 UTSW 6 49214459 missense probably damaging 1.00
R6959:Igf2bp3 UTSW 6 49117148 splice site probably null
R7380:Igf2bp3 UTSW 6 49108999 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGCTCCCTGTTCCATATCCAAG -3'
(R):5'- TGAAGACTCCTTGTGGTGAATAC -3'

Sequencing Primer
(F):5'- CCCTGTTCCATATCCAAGTATAAATG -3'
(R):5'- GTGAATACACACTGACTGTTCTC -3'
Posted On2014-10-01