Mutagenetix > Incidental Mutation

Incidental Mutation 'R2156:Trpm1'

234815

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

040159-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2156 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64234988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 806 (I806F)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: I806F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I806F

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107525
AA Change: I806F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: I806F

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: I690F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: I806F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,422,308		probably null	Het
Acaa2	T	C	18: 74,793,405		probably null	Het
Adam7	T	C	14: 68,511,343	Q485R	probably benign	Het
Adcy4	T	G	14: 55,769,170	T1069P	probably benign	Het
Arsj	T	C	3: 126,438,688	L361P	probably damaging	Het
Birc2	A	C	9: 7,826,938	L349R	probably damaging	Het
C1qa	T	C	4: 136,896,416	Y159C	probably damaging	Het
Cdh13	A	G	8: 119,236,964	K428E	probably damaging	Het
Cenpe	T	C	3: 135,247,474	M1563T	probably benign	Het
Col10a1	T	C	10: 34,395,700	V556A	probably benign	Het
Creg2	G	A	1: 39,623,170	L265F	probably damaging	Het
Cyp1a2	T	A	9: 57,682,150	D127V	probably damaging	Het
Cyp3a44	A	T	5: 145,803,670	Y53*	probably null	Het
Cyth1	C	T	11: 118,182,808	R233Q	probably damaging	Het
Dnmbp	G	A	19: 43,901,907	H474Y	possibly damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Ercc2	G	A	7: 19,386,792	R206H	possibly damaging	Het
Evx2	T	A	2: 74,656,016	H343L	probably damaging	Het
Fcrls	T	A	3: 87,257,341	I293F	probably benign	Het
Gcnt4	A	G	13: 96,946,466	E90G	probably damaging	Het
Gid8	T	G	2: 180,716,958	C139G	probably benign	Het
Gm11938	C	A	11: 99,603,107	C54F	probably damaging	Het
Gm3336	G	A	8: 70,721,860	V158I	probably benign	Het
Gm5415	T	A	1: 32,546,047	M261L	probably benign	Het
Gucy1b1	T	C	3: 82,061,020	N60D	probably benign	Het
Hdac7	T	C	15: 97,794,063	K810E	probably benign	Het
Hsp90ab1	A	G	17: 45,569,703	F361L	possibly damaging	Het
Igf2bp3	A	T	6: 49,108,924		probably null	Het
Inpp4b	T	A	8: 82,048,489	I772N	probably damaging	Het
Iqca	A	G	1: 90,089,516	L390P	possibly damaging	Het
Itgb2	C	T	10: 77,560,248	R586W	probably benign	Het
Itih1	A	G	14: 30,933,475	S588P	possibly damaging	Het
Iyd	T	A	10: 3,547,166		probably null	Het
Kl	A	G	5: 150,988,960	K725E	probably benign	Het
Layn	T	A	9: 51,057,397	M349L	probably benign	Het
Map3k5	T	C	10: 20,024,937	Y286H	probably damaging	Het
Med4	C	T	14: 73,518,032		probably benign	Het
Mfn1	T	A	3: 32,534,251	N42K	possibly damaging	Het
Mindy2	T	C	9: 70,656,592	D152G	probably benign	Het
Mrc2	A	G	11: 105,347,856		probably null	Het
Mrpl11	C	A	19: 4,962,469	A26E	probably damaging	Het
Msh6	G	A	17: 87,986,140	W774*	probably null	Het
Mtch1	A	T	17: 29,342,867	V121E	probably damaging	Het
Mtg2	G	T	2: 180,084,130	E178*	probably null	Het
Nbas	A	T	12: 13,441,509	N1461Y	probably damaging	Het
Ndfip2	A	G	14: 105,287,770	T65A	probably benign	Het
Ninl	G	T	2: 150,944,583	Q1146K	probably damaging	Het
Notch1	T	C	2: 26,460,861	D2089G	possibly damaging	Het
Notch3	C	T	17: 32,147,844	V906M	probably damaging	Het
Olfr606	A	G	7: 103,452,164	I276V	probably benign	Het
Olfr711	A	G	7: 106,971,568	Y259H	probably damaging	Het
Osmr	A	T	15: 6,844,410	Y169N	probably benign	Het
Ovgp1	T	C	3: 105,977,717	V124A	possibly damaging	Het
P2rx1	T	C	11: 73,014,113	M369T	probably benign	Het
Pde4dip	T	C	3: 97,724,218	Q1125R	probably damaging	Het
Podn	A	T	4: 108,021,695	V180E	probably damaging	Het
Pold1	A	T	7: 44,539,118	V475E	probably damaging	Het
Polg	A	G	7: 79,461,720	I261T	possibly damaging	Het
Satb1	G	T	17: 51,740,410	Q595K	probably benign	Het
Scaf8	T	A	17: 3,164,132		probably null	Het
Serpinb3a	C	T	1: 107,047,472		probably null	Het
Slc22a26	T	C	19: 7,802,115	D112G	probably damaging	Het
Slc25a23	A	G	17: 57,045,562	F441L	probably benign	Het
Slc25a53	T	C	X: 136,983,467	T42A	probably damaging	Het
Slc6a15	T	C	10: 103,393,408	Y103H	probably damaging	Het
Slx4	A	G	16: 3,986,359	S864P	probably benign	Het
Snap91	T	C	9: 86,825,077	E220G	probably damaging	Het
Spam1	T	C	6: 24,796,268	F73L	probably damaging	Het
Sphkap	C	T	1: 83,277,989	V393M	probably benign	Het
Spred2	T	C	11: 20,021,241	Y370H	probably damaging	Het
Sqle	T	C	15: 59,323,729		probably null	Het
Srrm2	A	G	17: 23,818,263	T1390A	probably benign	Het
Tas1r2	A	G	4: 139,669,041	R564G	possibly damaging	Het
Tbl2	G	T	5: 135,156,520		probably null	Het
Tcof1	T	C	18: 60,831,829	D606G	possibly damaging	Het
Tdpoz3	T	A	3: 93,826,780	L254H	probably damaging	Het
Ttc22	A	G	4: 106,639,040	D429G	probably benign	Het
Ube2o	C	A	11: 116,581,146	G90C	probably damaging	Het
Usp34	T	A	11: 23,382,602	F1110I	probably damaging	Het
Vmn2r82	T	C	10: 79,378,888	L235P	probably damaging	Het
Vps35	A	G	8: 85,286,500	V116A	probably benign	Het
Wdfy3	A	G	5: 101,898,425		probably null	Het
Zeb2	T	C	2: 44,988,809	K1138E	probably benign	Het
Zfp513	G	A	5: 31,200,522	T169I	probably benign	Het
Zfp629	T	C	7: 127,612,379	D86G	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CAGGATGTGAGCTGCTTTGC -3'
(R):5'- GCCCCTGTTAGCAAGCTTTC -3'

Sequencing Primer
(F):5'- TCCACTACGATGAGTTAAAACAAGTC -3'
(R):5'- CCCTGTTAGCAAGCTTTCTAAATGG -3'

Posted On

2014-10-01