Incidental Mutation 'R2156:Polg'
ID234817
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Namepolymerase (DNA directed), gamma
SynonymsPol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
MMRRC Submission 040159-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2156 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79446231-79466362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79461720 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 261 (I261T)
Ref Sequence ENSEMBL: ENSMUSP00000073551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073889] [ENSMUST00000125562] [ENSMUST00000132048] [ENSMUST00000149444]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073889
AA Change: I261T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: I261T

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125562
SMART Domains Protein: ENSMUSP00000143813
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 106 8e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139668
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142915
Predicted Effect probably benign
Transcript: ENSMUST00000143672
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149444
AA Change: I261T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176
AA Change: I261T

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205285
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,422,308 probably null Het
Acaa2 T C 18: 74,793,405 probably null Het
Adam7 T C 14: 68,511,343 Q485R probably benign Het
Adcy4 T G 14: 55,769,170 T1069P probably benign Het
Arsj T C 3: 126,438,688 L361P probably damaging Het
Birc2 A C 9: 7,826,938 L349R probably damaging Het
C1qa T C 4: 136,896,416 Y159C probably damaging Het
Cdh13 A G 8: 119,236,964 K428E probably damaging Het
Cenpe T C 3: 135,247,474 M1563T probably benign Het
Col10a1 T C 10: 34,395,700 V556A probably benign Het
Creg2 G A 1: 39,623,170 L265F probably damaging Het
Cyp1a2 T A 9: 57,682,150 D127V probably damaging Het
Cyp3a44 A T 5: 145,803,670 Y53* probably null Het
Cyth1 C T 11: 118,182,808 R233Q probably damaging Het
Dnmbp G A 19: 43,901,907 H474Y possibly damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ercc2 G A 7: 19,386,792 R206H possibly damaging Het
Evx2 T A 2: 74,656,016 H343L probably damaging Het
Fcrls T A 3: 87,257,341 I293F probably benign Het
Gcnt4 A G 13: 96,946,466 E90G probably damaging Het
Gid8 T G 2: 180,716,958 C139G probably benign Het
Gm11938 C A 11: 99,603,107 C54F probably damaging Het
Gm3336 G A 8: 70,721,860 V158I probably benign Het
Gm5415 T A 1: 32,546,047 M261L probably benign Het
Gucy1b1 T C 3: 82,061,020 N60D probably benign Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hsp90ab1 A G 17: 45,569,703 F361L possibly damaging Het
Igf2bp3 A T 6: 49,108,924 probably null Het
Inpp4b T A 8: 82,048,489 I772N probably damaging Het
Iqca A G 1: 90,089,516 L390P possibly damaging Het
Itgb2 C T 10: 77,560,248 R586W probably benign Het
Itih1 A G 14: 30,933,475 S588P possibly damaging Het
Iyd T A 10: 3,547,166 probably null Het
Kl A G 5: 150,988,960 K725E probably benign Het
Layn T A 9: 51,057,397 M349L probably benign Het
Map3k5 T C 10: 20,024,937 Y286H probably damaging Het
Med4 C T 14: 73,518,032 probably benign Het
Mfn1 T A 3: 32,534,251 N42K possibly damaging Het
Mindy2 T C 9: 70,656,592 D152G probably benign Het
Mrc2 A G 11: 105,347,856 probably null Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Msh6 G A 17: 87,986,140 W774* probably null Het
Mtch1 A T 17: 29,342,867 V121E probably damaging Het
Mtg2 G T 2: 180,084,130 E178* probably null Het
Nbas A T 12: 13,441,509 N1461Y probably damaging Het
Ndfip2 A G 14: 105,287,770 T65A probably benign Het
Ninl G T 2: 150,944,583 Q1146K probably damaging Het
Notch1 T C 2: 26,460,861 D2089G possibly damaging Het
Notch3 C T 17: 32,147,844 V906M probably damaging Het
Olfr606 A G 7: 103,452,164 I276V probably benign Het
Olfr711 A G 7: 106,971,568 Y259H probably damaging Het
Osmr A T 15: 6,844,410 Y169N probably benign Het
Ovgp1 T C 3: 105,977,717 V124A possibly damaging Het
P2rx1 T C 11: 73,014,113 M369T probably benign Het
Pde4dip T C 3: 97,724,218 Q1125R probably damaging Het
Podn A T 4: 108,021,695 V180E probably damaging Het
Pold1 A T 7: 44,539,118 V475E probably damaging Het
Satb1 G T 17: 51,740,410 Q595K probably benign Het
Scaf8 T A 17: 3,164,132 probably null Het
Serpinb3a C T 1: 107,047,472 probably null Het
Slc22a26 T C 19: 7,802,115 D112G probably damaging Het
Slc25a23 A G 17: 57,045,562 F441L probably benign Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Slc6a15 T C 10: 103,393,408 Y103H probably damaging Het
Slx4 A G 16: 3,986,359 S864P probably benign Het
Snap91 T C 9: 86,825,077 E220G probably damaging Het
Spam1 T C 6: 24,796,268 F73L probably damaging Het
Sphkap C T 1: 83,277,989 V393M probably benign Het
Spred2 T C 11: 20,021,241 Y370H probably damaging Het
Sqle T C 15: 59,323,729 probably null Het
Srrm2 A G 17: 23,818,263 T1390A probably benign Het
Tas1r2 A G 4: 139,669,041 R564G possibly damaging Het
Tbl2 G T 5: 135,156,520 probably null Het
Tcof1 T C 18: 60,831,829 D606G possibly damaging Het
Tdpoz3 T A 3: 93,826,780 L254H probably damaging Het
Trpm1 A T 7: 64,234,988 I806F probably damaging Het
Ttc22 A G 4: 106,639,040 D429G probably benign Het
Ube2o C A 11: 116,581,146 G90C probably damaging Het
Usp34 T A 11: 23,382,602 F1110I probably damaging Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Vps35 A G 8: 85,286,500 V116A probably benign Het
Wdfy3 A G 5: 101,898,425 probably null Het
Zeb2 T C 2: 44,988,809 K1138E probably benign Het
Zfp513 G A 5: 31,200,522 T169I probably benign Het
Zfp629 T C 7: 127,612,379 D86G probably benign Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0416:Polg UTSW 7 79452240 unclassified probably benign
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R3720:Polg UTSW 7 79456791 nonsense probably null
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4127:Polg UTSW 7 79455537 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R4888:Polg UTSW 7 79464605 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6754:Polg UTSW 7 79459836 missense probably damaging 1.00
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCAGCAGCTGAGCAGAGATC -3'
(R):5'- CTAGTCCTTCGTGGTAACCCTG -3'

Sequencing Primer
(F):5'- GATCAAGCAAAGCTGGTCAAC -3'
(R):5'- CGTGGTAACCCTGTCCAC -3'
Posted On2014-10-01