Incidental Mutation 'R2156:Inpp4b'
ID 234823
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Name inositol polyphosphate-4-phosphatase, type II
Synonyms E130107I17Rik
MMRRC Submission 040159-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R2156 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 82069185-82854543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82775118 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 772 (I772N)
Ref Sequence ENSEMBL: ENSMUSP00000150520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000217122] [ENSMUST00000215332]
AlphaFold Q6P1Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000042529
AA Change: I755N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: I755N

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109851
AA Change: I640N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: I640N

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109852
AA Change: I772N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: I772N

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169116
AA Change: I772N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: I772N

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect probably damaging
Transcript: ENSMUST00000170160
AA Change: I587N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: I587N

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: I772N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: I772N

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213285
AA Change: I772N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217122
AA Change: I772N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: I772N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,313,134 (GRCm39) probably null Het
Acaa2 T C 18: 74,926,476 (GRCm39) probably null Het
Adam7 T C 14: 68,748,792 (GRCm39) Q485R probably benign Het
Adcy4 T G 14: 56,006,627 (GRCm39) T1069P probably benign Het
Arsj T C 3: 126,232,337 (GRCm39) L361P probably damaging Het
Birc2 A C 9: 7,826,939 (GRCm39) L349R probably damaging Het
C1qa T C 4: 136,623,727 (GRCm39) Y159C probably damaging Het
Cdh13 A G 8: 119,963,703 (GRCm39) K428E probably damaging Het
Cenpe T C 3: 134,953,235 (GRCm39) M1563T probably benign Het
Col10a1 T C 10: 34,271,696 (GRCm39) V556A probably benign Het
Creg2 G A 1: 39,662,338 (GRCm39) L265F probably damaging Het
Cyp1a2 T A 9: 57,589,433 (GRCm39) D127V probably damaging Het
Cyp3a44 A T 5: 145,740,480 (GRCm39) Y53* probably null Het
Cyth1 C T 11: 118,073,634 (GRCm39) R233Q probably damaging Het
Dnmbp G A 19: 43,890,346 (GRCm39) H474Y possibly damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Ercc2 G A 7: 19,120,717 (GRCm39) R206H possibly damaging Het
Evx2 T A 2: 74,486,360 (GRCm39) H343L probably damaging Het
Fcrl2 T A 3: 87,164,648 (GRCm39) I293F probably benign Het
Gcnt4 A G 13: 97,082,974 (GRCm39) E90G probably damaging Het
Gid8 T G 2: 180,358,751 (GRCm39) C139G probably benign Het
Gm11938 C A 11: 99,493,933 (GRCm39) C54F probably damaging Het
Gm3336 G A 8: 71,174,509 (GRCm39) V158I probably benign Het
Gucy1b1 T C 3: 81,968,327 (GRCm39) N60D probably benign Het
Hdac7 T C 15: 97,691,944 (GRCm39) K810E probably benign Het
Hsp90ab1 A G 17: 45,880,629 (GRCm39) F361L possibly damaging Het
Igf2bp3 A T 6: 49,085,858 (GRCm39) probably null Het
Iqca1 A G 1: 90,017,238 (GRCm39) L390P possibly damaging Het
Itgb2 C T 10: 77,396,082 (GRCm39) R586W probably benign Het
Itih1 A G 14: 30,655,432 (GRCm39) S588P possibly damaging Het
Iyd T A 10: 3,497,166 (GRCm39) probably null Het
Kl A G 5: 150,912,425 (GRCm39) K725E probably benign Het
Layn T A 9: 50,968,697 (GRCm39) M349L probably benign Het
Map3k5 T C 10: 19,900,683 (GRCm39) Y286H probably damaging Het
Med4 C T 14: 73,755,472 (GRCm39) probably benign Het
Mfn1 T A 3: 32,588,400 (GRCm39) N42K possibly damaging Het
Mindy2 T C 9: 70,563,874 (GRCm39) D152G probably benign Het
Mrc2 A G 11: 105,238,682 (GRCm39) probably null Het
Mrpl11 C A 19: 5,012,497 (GRCm39) A26E probably damaging Het
Msh6 G A 17: 88,293,568 (GRCm39) W774* probably null Het
Mtch1 A T 17: 29,561,841 (GRCm39) V121E probably damaging Het
Mtg2 G T 2: 179,725,923 (GRCm39) E178* probably null Het
Nbas A T 12: 13,491,510 (GRCm39) N1461Y probably damaging Het
Ndfip2 A G 14: 105,525,204 (GRCm39) T65A probably benign Het
Ninl G T 2: 150,786,503 (GRCm39) Q1146K probably damaging Het
Notch1 T C 2: 26,350,873 (GRCm39) D2089G possibly damaging Het
Notch3 C T 17: 32,366,818 (GRCm39) V906M probably damaging Het
Or51l14 A G 7: 103,101,371 (GRCm39) I276V probably benign Het
Or6b6 A G 7: 106,570,775 (GRCm39) Y259H probably damaging Het
Osmr A T 15: 6,873,891 (GRCm39) Y169N probably benign Het
Ovgp1 T C 3: 105,885,033 (GRCm39) V124A possibly damaging Het
P2rx1 T C 11: 72,904,939 (GRCm39) M369T probably benign Het
Pde4dip T C 3: 97,631,534 (GRCm39) Q1125R probably damaging Het
Podn A T 4: 107,878,892 (GRCm39) V180E probably damaging Het
Pold1 A T 7: 44,188,542 (GRCm39) V475E probably damaging Het
Polg A G 7: 79,111,468 (GRCm39) I261T possibly damaging Het
Satb1 G T 17: 52,047,438 (GRCm39) Q595K probably benign Het
Scaf8 T A 17: 3,214,407 (GRCm39) probably null Het
Semp2l1 T A 1: 32,585,128 (GRCm39) M261L probably benign Het
Serpinb3a C T 1: 106,975,202 (GRCm39) probably null Het
Slc22a26 T C 19: 7,779,480 (GRCm39) D112G probably damaging Het
Slc25a23 A G 17: 57,352,562 (GRCm39) F441L probably benign Het
Slc25a53 T C X: 135,884,216 (GRCm39) T42A probably damaging Het
Slc6a15 T C 10: 103,229,269 (GRCm39) Y103H probably damaging Het
Slx4 A G 16: 3,804,223 (GRCm39) S864P probably benign Het
Snap91 T C 9: 86,707,130 (GRCm39) E220G probably damaging Het
Spam1 T C 6: 24,796,267 (GRCm39) F73L probably damaging Het
Sphkap C T 1: 83,255,710 (GRCm39) V393M probably benign Het
Spred2 T C 11: 19,971,241 (GRCm39) Y370H probably damaging Het
Sqle T C 15: 59,195,578 (GRCm39) probably null Het
Srrm2 A G 17: 24,037,237 (GRCm39) T1390A probably benign Het
Tas1r2 A G 4: 139,396,352 (GRCm39) R564G possibly damaging Het
Tbl2 G T 5: 135,185,374 (GRCm39) probably null Het
Tcof1 T C 18: 60,964,901 (GRCm39) D606G possibly damaging Het
Tdpoz3 T A 3: 93,734,087 (GRCm39) L254H probably damaging Het
Trpm1 A T 7: 63,884,736 (GRCm39) I806F probably damaging Het
Ttc22 A G 4: 106,496,237 (GRCm39) D429G probably benign Het
Ube2o C A 11: 116,471,972 (GRCm39) G90C probably damaging Het
Usp34 T A 11: 23,332,602 (GRCm39) F1110I probably damaging Het
Vmn2r82 T C 10: 79,214,722 (GRCm39) L235P probably damaging Het
Vps35 A G 8: 86,013,129 (GRCm39) V116A probably benign Het
Wdfy3 A G 5: 102,046,291 (GRCm39) probably null Het
Zeb2 T C 2: 44,878,821 (GRCm39) K1138E probably benign Het
Zfp513 G A 5: 31,357,866 (GRCm39) T169I probably benign Het
Zfp629 T C 7: 127,211,551 (GRCm39) D86G probably benign Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 82,583,379 (GRCm39) missense probably damaging 1.00
IGL01481:Inpp4b APN 8 82,724,009 (GRCm39) missense probably damaging 1.00
IGL01509:Inpp4b APN 8 82,617,332 (GRCm39) splice site probably benign
IGL01515:Inpp4b APN 8 82,679,340 (GRCm39) missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82,737,292 (GRCm39) missense probably benign 0.03
IGL01643:Inpp4b APN 8 82,798,400 (GRCm39) missense probably damaging 0.97
IGL01736:Inpp4b APN 8 82,723,968 (GRCm39) missense probably benign 0.00
IGL02154:Inpp4b APN 8 82,696,130 (GRCm39) splice site probably benign
IGL02327:Inpp4b APN 8 82,768,591 (GRCm39) missense probably benign 0.01
IGL02413:Inpp4b APN 8 82,759,800 (GRCm39) missense probably benign
IGL02652:Inpp4b APN 8 82,497,429 (GRCm39) splice site probably benign
IGL02678:Inpp4b APN 8 82,583,373 (GRCm39) missense probably damaging 1.00
IGL03146:Inpp4b APN 8 82,470,410 (GRCm39) missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 82,419,639 (GRCm39) intron probably benign
PIT4280001:Inpp4b UTSW 8 82,761,046 (GRCm39) missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82,772,896 (GRCm39) missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82,768,564 (GRCm39) missense probably damaging 1.00
R0083:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 82,497,546 (GRCm39) missense probably benign 0.00
R0285:Inpp4b UTSW 8 82,761,145 (GRCm39) splice site probably benign
R0363:Inpp4b UTSW 8 82,610,886 (GRCm39) splice site probably benign
R0364:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R0471:Inpp4b UTSW 8 82,768,528 (GRCm39) missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 82,723,966 (GRCm39) missense probably benign 0.00
R0562:Inpp4b UTSW 8 82,494,780 (GRCm39) missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R1081:Inpp4b UTSW 8 82,795,653 (GRCm39) missense probably damaging 0.97
R1251:Inpp4b UTSW 8 82,617,382 (GRCm39) missense probably benign 0.01
R1374:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably null
R1445:Inpp4b UTSW 8 82,679,463 (GRCm39) splice site probably null
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1647:Inpp4b UTSW 8 82,583,403 (GRCm39) splice site probably benign
R1754:Inpp4b UTSW 8 82,497,440 (GRCm39) missense probably damaging 1.00
R1759:Inpp4b UTSW 8 82,494,732 (GRCm39) missense probably benign 0.06
R2085:Inpp4b UTSW 8 82,678,903 (GRCm39) missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82,848,004 (GRCm39) nonsense probably null
R2175:Inpp4b UTSW 8 82,583,328 (GRCm39) missense probably damaging 1.00
R2191:Inpp4b UTSW 8 82,723,931 (GRCm39) missense probably damaging 1.00
R2401:Inpp4b UTSW 8 82,723,968 (GRCm39) missense probably benign 0.00
R2475:Inpp4b UTSW 8 82,768,607 (GRCm39) missense probably benign 0.09
R2512:Inpp4b UTSW 8 82,737,179 (GRCm39) missense probably damaging 1.00
R2919:Inpp4b UTSW 8 82,711,958 (GRCm39) missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 82,629,467 (GRCm39) missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 82,678,890 (GRCm39) missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R4590:Inpp4b UTSW 8 82,468,040 (GRCm39) start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 82,696,164 (GRCm39) missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82,849,282 (GRCm39) missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82,849,253 (GRCm39) missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82,759,837 (GRCm39) missense probably damaging 1.00
R5219:Inpp4b UTSW 8 82,610,785 (GRCm39) missense probably benign 0.01
R5228:Inpp4b UTSW 8 82,494,744 (GRCm39) missense probably damaging 0.99
R5557:Inpp4b UTSW 8 82,678,888 (GRCm39) missense probably damaging 0.99
R5627:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably benign
R5691:Inpp4b UTSW 8 82,617,323 (GRCm39) intron probably benign
R6186:Inpp4b UTSW 8 82,772,863 (GRCm39) missense probably damaging 0.99
R6213:Inpp4b UTSW 8 82,724,019 (GRCm39) missense probably damaging 1.00
R6232:Inpp4b UTSW 8 82,678,813 (GRCm39) missense probably damaging 1.00
R6283:Inpp4b UTSW 8 82,497,462 (GRCm39) missense probably damaging 1.00
R6302:Inpp4b UTSW 8 82,494,806 (GRCm39) missense probably benign 0.00
R6309:Inpp4b UTSW 8 82,768,546 (GRCm39) missense probably damaging 1.00
R6360:Inpp4b UTSW 8 82,629,481 (GRCm39) missense probably benign 0.20
R6477:Inpp4b UTSW 8 82,571,343 (GRCm39) splice site probably null
R6773:Inpp4b UTSW 8 82,583,249 (GRCm39) intron probably benign
R6968:Inpp4b UTSW 8 82,571,086 (GRCm39) missense probably benign 0.18
R7147:Inpp4b UTSW 8 82,629,400 (GRCm39) missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82,798,374 (GRCm39) missense probably damaging 1.00
R7409:Inpp4b UTSW 8 82,679,314 (GRCm39) splice site probably null
R7455:Inpp4b UTSW 8 82,798,332 (GRCm39) missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82,772,968 (GRCm39) missense probably damaging 1.00
R7844:Inpp4b UTSW 8 82,467,949 (GRCm39) start gained probably benign
R7958:Inpp4b UTSW 8 82,696,218 (GRCm39) missense probably damaging 1.00
R8440:Inpp4b UTSW 8 82,768,524 (GRCm39) missense probably damaging 1.00
R9160:Inpp4b UTSW 8 82,610,782 (GRCm39) missense possibly damaging 0.55
R9303:Inpp4b UTSW 8 82,759,758 (GRCm39) missense probably damaging 1.00
R9390:Inpp4b UTSW 8 82,497,522 (GRCm39) missense probably damaging 1.00
R9583:Inpp4b UTSW 8 82,497,555 (GRCm39) critical splice donor site probably null
R9705:Inpp4b UTSW 8 82,772,890 (GRCm39) missense probably benign 0.14
R9778:Inpp4b UTSW 8 82,775,160 (GRCm39) missense probably benign
RF003:Inpp4b UTSW 8 82,696,150 (GRCm39) nonsense probably null
Z1088:Inpp4b UTSW 8 82,795,560 (GRCm39) critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82,795,630 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCTTACAAGCGAGCTGTAAAC -3'
(R):5'- ATGCTACTTTACTCACAGGCC -3'

Sequencing Primer
(F):5'- tcttcttcctcctcctcttc -3'
(R):5'- ACAGGCCTCTTTTGCTTAAGAG -3'
Posted On 2014-10-01