Incidental Mutation 'R2157:Apoa1'
ID234923
Institutional Source Beutler Lab
Gene Symbol Apoa1
Ensembl Gene ENSMUSG00000032083
Gene Nameapolipoprotein A-I
SynonymsLvtw-1, Sep-2, Sep2, Sep-1, Alp-1, Apoa-1, Brp-14, Ltw-1
MMRRC Submission 040160-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.563) question?
Stock #R2157 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location46228580-46230466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46229173 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 34 (V34A)
Ref Sequence ENSEMBL: ENSMUSP00000150525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034586] [ENSMUST00000034588] [ENSMUST00000118649] [ENSMUST00000121916] [ENSMUST00000126865] [ENSMUST00000132155]
Predicted Effect probably benign
Transcript: ENSMUST00000034586
SMART Domains Protein: ENSMUSP00000034586
Gene: ENSMUSG00000032081

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Apo-CIII 22 91 2.4e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000034588
AA Change: V34A

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034588
Gene: ENSMUSG00000032083
AA Change: V34A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 68 259 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118649
SMART Domains Protein: ENSMUSP00000113058
Gene: ENSMUSG00000032081

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Apo-CIII 22 91 2.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121916
SMART Domains Protein: ENSMUSP00000113126
Gene: ENSMUSG00000032081

DomainStartEndE-ValueType
Pfam:Apo-CIII 60 129 7.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126865
SMART Domains Protein: ENSMUSP00000121032
Gene: ENSMUSG00000034135

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
S_TKc 66 317 5.4e-102 SMART
internal_repeat_1 444 487 1.55e-6 PROSPERO
low complexity region 531 540 N/A INTRINSIC
internal_repeat_1 587 631 1.55e-6 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 723 743 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 880 893 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1046 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132155
AA Change: V34A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214729
Meta Mutation Damage Score 0.3395 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is the major protein component of plasma high density lipoprotein (HDL). This protein facilitates the removal of cholesterol and other fats from tissues by transporting them to the liver for excretion. This protein is a cofactor for lecithin cholesterolacyltransferase, an enzyme that catalyzes the conversion of free cholesterol to cholesteryl esters. Mutations in this gene in humans causes familial HDL deficiency, Tangier disease and familial visceral amyloidosis. Similar clinical features are exhibited by mice with mutations in this gene. This gene is clustered with three other apolipoprotein genes on chromosome 9. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced high density lipoprotein (HDL), non-HDL cholesterol, and cholesterol ester levels, increased plasma triglyceride and free cholesterol levels, and impaired corticosteroid synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A T 8: 124,651,429 probably benign Het
4930590J08Rik A G 6: 91,917,698 probably null Het
4930590J08Rik T A 6: 91,942,487 M709K possibly damaging Het
A930011G23Rik T G 5: 99,232,097 I394L probably damaging Het
Abca13 A C 11: 9,577,170 M4528L probably damaging Het
Abcb1b G A 5: 8,824,791 A484T probably benign Het
Actn1 A T 12: 80,173,117 M660K probably benign Het
Adgra3 G T 5: 50,001,941 N322K possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Amotl2 A G 9: 102,730,589 probably benign Het
Arrdc1 G A 2: 24,926,975 A113V probably damaging Het
As3mt A G 19: 46,707,792 D13G probably benign Het
C77080 C T 4: 129,224,124 R249H possibly damaging Het
Cald1 A G 6: 34,686,041 Q13R possibly damaging Het
Ccdc28a G A 10: 18,230,455 T41I probably benign Het
Ccdc30 A T 4: 119,333,724 probably benign Het
Cct2 T C 10: 117,062,809 probably benign Het
Cdh12 T C 15: 21,583,787 I571T possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Comp C T 8: 70,379,570 Q554* probably null Het
Csf2ra T C 19: 61,227,071 T70A probably benign Het
Csmd3 T C 15: 47,695,787 E2256G probably damaging Het
Dicer1 A T 12: 104,702,949 V1158D probably benign Het
Dner A G 1: 84,383,938 F650S possibly damaging Het
Dnm3 T C 1: 162,307,893 N437S possibly damaging Het
Dpy19l2 A T 9: 24,584,632 C597S probably benign Het
Dpy19l2 T C 9: 24,680,780 I176V probably benign Het
Edf1 T C 2: 25,558,031 probably null Het
Enpp3 A G 10: 24,776,878 F727S probably damaging Het
Epb42 C T 2: 121,021,762 M583I probably benign Het
Foxred1 A G 9: 35,205,363 F117S probably damaging Het
Fstl5 T A 3: 76,708,065 M811K possibly damaging Het
Gm5117 A T 8: 31,738,194 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Grik1 G A 16: 88,056,124 A57V probably damaging Het
Hdgfl2 G A 17: 56,098,691 V476I possibly damaging Het
Il17b G T 18: 61,690,368 W91L probably damaging Het
Jph4 C A 14: 55,113,527 R344L probably benign Het
Map3k21 A G 8: 125,937,266 D522G probably benign Het
Mast2 A G 4: 116,322,283 L398S probably damaging Het
Mbtd1 A G 11: 93,910,388 T132A probably benign Het
Mbtps1 G T 8: 119,542,727 T208K probably benign Het
Mr1 A G 1: 155,146,630 probably null Het
Mthfsd G A 8: 121,101,501 L140F probably damaging Het
Mybpc2 C G 7: 44,509,845 D594H possibly damaging Het
Nalcn T C 14: 123,409,752 M570V probably benign Het
Ncam2 T C 16: 81,490,389 I397T probably damaging Het
Ndufs4 C T 13: 114,316,978 V75I probably damaging Het
Nek4 T A 14: 30,979,968 probably null Het
Nfatc1 G T 18: 80,635,845 A762D possibly damaging Het
Npc1 A G 18: 12,191,809 I1209T probably damaging Het
Olfr1206 A T 2: 88,864,869 N88I probably benign Het
Olfr370 T C 8: 83,541,621 I159T probably benign Het
Pak7 T C 2: 136,100,957 D421G probably damaging Het
Pias1 A G 9: 62,912,830 V285A possibly damaging Het
Pigg T A 5: 108,318,889 I212N probably damaging Het
Plcd3 A T 11: 103,071,148 C711S probably benign Het
Plscr5 G A 9: 92,198,497 R12K probably benign Het
Plxna4 T C 6: 32,516,974 I236V probably benign Het
Ppp1r26 T C 2: 28,452,358 F667L probably benign Het
Pqlc2 A T 4: 139,301,855 V106D probably damaging Het
Prkx A G X: 77,771,314 F247L probably benign Het
Qpct G A 17: 79,070,686 R95Q probably benign Het
Ralgapb G T 2: 158,437,472 M159I probably benign Het
Rnf145 T C 11: 44,555,170 L277P probably damaging Het
Scn9a A G 2: 66,536,325 S705P probably damaging Het
Slc4a8 A G 15: 100,806,373 T750A probably damaging Het
Syne2 A G 12: 76,094,456 E6114G probably damaging Het
Tat T C 8: 109,997,604 M375T probably damaging Het
Tex10 C T 4: 48,436,522 probably benign Het
Tmprss11e T C 5: 86,713,728 K320E probably benign Het
Tnr T C 1: 159,858,270 I357T probably damaging Het
Vmn1r229 A T 17: 20,815,376 R294S possibly damaging Het
Vmn2r116 G A 17: 23,401,469 D726N probably damaging Het
Vpreb2 T A 16: 17,981,070 L140* probably null Het
Wfs1 G A 5: 36,967,942 P535L probably damaging Het
Xdh A G 17: 73,922,537 L307P probably damaging Het
Zfp160 A G 17: 21,020,828 S53G probably benign Het
Zfp319 A G 8: 95,328,031 C515R probably damaging Het
Zfp747 A G 7: 127,375,757 F24L possibly damaging Het
Zzef1 A T 11: 72,848,634 probably benign Het
Other mutations in Apoa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Apoa1 APN 9 46229250 missense possibly damaging 0.78
R0391:Apoa1 UTSW 9 46229842 missense probably benign 0.00
R2113:Apoa1 UTSW 9 46229214 missense probably damaging 1.00
R2177:Apoa1 UTSW 9 46230073 nonsense probably null
R3854:Apoa1 UTSW 9 46230223 missense probably benign 0.02
R7436:Apoa1 UTSW 9 46229802 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGAAAGCTGTGGTGCTGGC -3'
(R):5'- AGCTCAGTTCCAGCATCTTC -3'

Sequencing Primer
(F):5'- TTCCTGACAGGTAGGTGCCTC -3'
(R):5'- AGTTCCAGCATCTTCTCACTGG -3'
Posted On2014-10-01