Incidental Mutation 'R2157:Plcd3'
ID234934
Institutional Source Beutler Lab
Gene Symbol Plcd3
Ensembl Gene ENSMUSG00000020937
Gene Namephospholipase C, delta 3
Synonyms2610205J15Rik
MMRRC Submission 040160-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R2157 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103070304-103101658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103071148 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 711 (C711S)
Ref Sequence ENSEMBL: ENSMUSP00000099366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021314] [ENSMUST00000103077]
Predicted Effect probably benign
Transcript: ENSMUST00000021314
SMART Domains Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:NMT 137 294 6.7e-77 PFAM
Pfam:NMT_C 308 495 1.4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103077
AA Change: C711S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099366
Gene: ENSMUSG00000020937
AA Change: C711S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
PH 61 170 4.07e-5 SMART
Pfam:EF-hand_10 197 246 1.8e-27 PFAM
Pfam:EF-hand_like 251 332 2.6e-24 PFAM
PLCXc 333 478 7.75e-85 SMART
low complexity region 495 512 N/A INTRINSIC
PLCYc 524 640 3.96e-50 SMART
C2 657 763 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124740
Predicted Effect unknown
Transcript: ENSMUST00000128650
AA Change: C396S
SMART Domains Protein: ENSMUSP00000117455
Gene: ENSMUSG00000020937
AA Change: C396S

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
PLCXc 19 164 7.75e-85 SMART
coiled coil region 172 206 N/A INTRINSIC
PLCYc 210 326 3.96e-50 SMART
C2 343 449 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A T 8: 124,651,429 probably benign Het
4930590J08Rik A G 6: 91,917,698 probably null Het
4930590J08Rik T A 6: 91,942,487 M709K possibly damaging Het
A930011G23Rik T G 5: 99,232,097 I394L probably damaging Het
Abca13 A C 11: 9,577,170 M4528L probably damaging Het
Abcb1b G A 5: 8,824,791 A484T probably benign Het
Actn1 A T 12: 80,173,117 M660K probably benign Het
Adgra3 G T 5: 50,001,941 N322K possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Amotl2 A G 9: 102,730,589 probably benign Het
Apoa1 T C 9: 46,229,173 V34A probably damaging Het
Arrdc1 G A 2: 24,926,975 A113V probably damaging Het
As3mt A G 19: 46,707,792 D13G probably benign Het
C77080 C T 4: 129,224,124 R249H possibly damaging Het
Cald1 A G 6: 34,686,041 Q13R possibly damaging Het
Ccdc28a G A 10: 18,230,455 T41I probably benign Het
Ccdc30 A T 4: 119,333,724 probably benign Het
Cct2 T C 10: 117,062,809 probably benign Het
Cdh12 T C 15: 21,583,787 I571T possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Comp C T 8: 70,379,570 Q554* probably null Het
Csf2ra T C 19: 61,227,071 T70A probably benign Het
Csmd3 T C 15: 47,695,787 E2256G probably damaging Het
Dicer1 A T 12: 104,702,949 V1158D probably benign Het
Dner A G 1: 84,383,938 F650S possibly damaging Het
Dnm3 T C 1: 162,307,893 N437S possibly damaging Het
Dpy19l2 A T 9: 24,584,632 C597S probably benign Het
Dpy19l2 T C 9: 24,680,780 I176V probably benign Het
Edf1 T C 2: 25,558,031 probably null Het
Enpp3 A G 10: 24,776,878 F727S probably damaging Het
Epb42 C T 2: 121,021,762 M583I probably benign Het
Foxred1 A G 9: 35,205,363 F117S probably damaging Het
Fstl5 T A 3: 76,708,065 M811K possibly damaging Het
Gm5117 A T 8: 31,738,194 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Grik1 G A 16: 88,056,124 A57V probably damaging Het
Hdgfl2 G A 17: 56,098,691 V476I possibly damaging Het
Il17b G T 18: 61,690,368 W91L probably damaging Het
Jph4 C A 14: 55,113,527 R344L probably benign Het
Map3k21 A G 8: 125,937,266 D522G probably benign Het
Mast2 A G 4: 116,322,283 L398S probably damaging Het
Mbtd1 A G 11: 93,910,388 T132A probably benign Het
Mbtps1 G T 8: 119,542,727 T208K probably benign Het
Mr1 A G 1: 155,146,630 probably null Het
Mthfsd G A 8: 121,101,501 L140F probably damaging Het
Mybpc2 C G 7: 44,509,845 D594H possibly damaging Het
Nalcn T C 14: 123,409,752 M570V probably benign Het
Ncam2 T C 16: 81,490,389 I397T probably damaging Het
Ndufs4 C T 13: 114,316,978 V75I probably damaging Het
Nek4 T A 14: 30,979,968 probably null Het
Nfatc1 G T 18: 80,635,845 A762D possibly damaging Het
Npc1 A G 18: 12,191,809 I1209T probably damaging Het
Olfr1206 A T 2: 88,864,869 N88I probably benign Het
Olfr370 T C 8: 83,541,621 I159T probably benign Het
Pak7 T C 2: 136,100,957 D421G probably damaging Het
Pias1 A G 9: 62,912,830 V285A possibly damaging Het
Pigg T A 5: 108,318,889 I212N probably damaging Het
Plscr5 G A 9: 92,198,497 R12K probably benign Het
Plxna4 T C 6: 32,516,974 I236V probably benign Het
Ppp1r26 T C 2: 28,452,358 F667L probably benign Het
Pqlc2 A T 4: 139,301,855 V106D probably damaging Het
Prkx A G X: 77,771,314 F247L probably benign Het
Qpct G A 17: 79,070,686 R95Q probably benign Het
Ralgapb G T 2: 158,437,472 M159I probably benign Het
Rnf145 T C 11: 44,555,170 L277P probably damaging Het
Scn9a A G 2: 66,536,325 S705P probably damaging Het
Slc4a8 A G 15: 100,806,373 T750A probably damaging Het
Syne2 A G 12: 76,094,456 E6114G probably damaging Het
Tat T C 8: 109,997,604 M375T probably damaging Het
Tex10 C T 4: 48,436,522 probably benign Het
Tmprss11e T C 5: 86,713,728 K320E probably benign Het
Tnr T C 1: 159,858,270 I357T probably damaging Het
Vmn1r229 A T 17: 20,815,376 R294S possibly damaging Het
Vmn2r116 G A 17: 23,401,469 D726N probably damaging Het
Vpreb2 T A 16: 17,981,070 L140* probably null Het
Wfs1 G A 5: 36,967,942 P535L probably damaging Het
Xdh A G 17: 73,922,537 L307P probably damaging Het
Zfp160 A G 17: 21,020,828 S53G probably benign Het
Zfp319 A G 8: 95,328,031 C515R probably damaging Het
Zfp747 A G 7: 127,375,757 F24L possibly damaging Het
Zzef1 A T 11: 72,848,634 probably benign Het
Other mutations in Plcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Plcd3 APN 11 103077870 missense probably benign 0.16
IGL01906:Plcd3 APN 11 103076856 missense probably damaging 1.00
IGL02325:Plcd3 APN 11 103080621 nonsense probably null
IGL02634:Plcd3 APN 11 103077827 missense probably damaging 1.00
IGL02852:Plcd3 APN 11 103073805 missense probably damaging 1.00
IGL03025:Plcd3 APN 11 103074898 missense probably benign 0.24
IGL02837:Plcd3 UTSW 11 103071103 missense possibly damaging 0.92
IGL02988:Plcd3 UTSW 11 103076742 missense probably benign
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0062:Plcd3 UTSW 11 103074894 missense probably benign
R0452:Plcd3 UTSW 11 103071259 unclassified probably benign
R0529:Plcd3 UTSW 11 103080187 missense probably benign 0.00
R0556:Plcd3 UTSW 11 103077806 missense probably damaging 1.00
R1463:Plcd3 UTSW 11 103078373 missense probably damaging 1.00
R1752:Plcd3 UTSW 11 103080259 missense probably benign 0.01
R2519:Plcd3 UTSW 11 103080400 missense possibly damaging 0.80
R3809:Plcd3 UTSW 11 103101383 missense probably null 0.03
R4167:Plcd3 UTSW 11 103078464 missense probably damaging 0.98
R5100:Plcd3 UTSW 11 103078349 missense probably benign
R5387:Plcd3 UTSW 11 103078455 missense probably damaging 1.00
R5589:Plcd3 UTSW 11 103077803 missense probably benign 0.01
R5700:Plcd3 UTSW 11 103073763 missense probably benign 0.00
R5754:Plcd3 UTSW 11 103073766 missense possibly damaging 0.67
R5936:Plcd3 UTSW 11 103078347 missense probably damaging 1.00
R6059:Plcd3 UTSW 11 103080401 missense possibly damaging 0.80
R6102:Plcd3 UTSW 11 103080644 missense probably damaging 0.99
R6480:Plcd3 UTSW 11 103074931 missense possibly damaging 0.79
R6481:Plcd3 UTSW 11 103077767 missense probably damaging 1.00
R6566:Plcd3 UTSW 11 103073800 missense probably damaging 1.00
R7098:Plcd3 UTSW 11 103077863 missense probably damaging 1.00
R7165:Plcd3 UTSW 11 103079613 missense probably damaging 1.00
R7392:Plcd3 UTSW 11 103101557 unclassified probably benign
R7484:Plcd3 UTSW 11 103071719 missense probably damaging 1.00
R7606:Plcd3 UTSW 11 103076857 missense probably damaging 1.00
R7777:Plcd3 UTSW 11 103074655 missense probably benign 0.33
R7857:Plcd3 UTSW 11 103077934 missense probably benign 0.12
R7940:Plcd3 UTSW 11 103077934 missense probably benign 0.12
X0023:Plcd3 UTSW 11 103080208 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAAGGCAGCCACAAGTCAG -3'
(R):5'- AGAGAAGCCCAGCTCCATTG -3'

Sequencing Primer
(F):5'- CACAAGTCAGAGGCTGGGACTC -3'
(R):5'- CCATTGTGGATCCTCTGGTGC -3'
Posted On2014-10-01