Incidental Mutation 'R2157:Actn1'
ID234936
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
MMRRC Submission 040160-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R2157 (G1)
Quality Score210
Status Validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80173117 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 660 (M660K)
Ref Sequence ENSEMBL: ENSMUSP00000021554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably benign
Transcript: ENSMUST00000021554
AA Change: M660K

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: M660K

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167327
AA Change: M660K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: M660K

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219634
Meta Mutation Damage Score 0.1523 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A T 8: 124,651,429 probably benign Het
4930590J08Rik A G 6: 91,917,698 probably null Het
4930590J08Rik T A 6: 91,942,487 M709K possibly damaging Het
A930011G23Rik T G 5: 99,232,097 I394L probably damaging Het
Abca13 A C 11: 9,577,170 M4528L probably damaging Het
Abcb1b G A 5: 8,824,791 A484T probably benign Het
Adgra3 G T 5: 50,001,941 N322K possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Amotl2 A G 9: 102,730,589 probably benign Het
Apoa1 T C 9: 46,229,173 V34A probably damaging Het
Arrdc1 G A 2: 24,926,975 A113V probably damaging Het
As3mt A G 19: 46,707,792 D13G probably benign Het
C77080 C T 4: 129,224,124 R249H possibly damaging Het
Cald1 A G 6: 34,686,041 Q13R possibly damaging Het
Ccdc28a G A 10: 18,230,455 T41I probably benign Het
Ccdc30 A T 4: 119,333,724 probably benign Het
Cct2 T C 10: 117,062,809 probably benign Het
Cdh12 T C 15: 21,583,787 I571T possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Comp C T 8: 70,379,570 Q554* probably null Het
Csf2ra T C 19: 61,227,071 T70A probably benign Het
Csmd3 T C 15: 47,695,787 E2256G probably damaging Het
Dicer1 A T 12: 104,702,949 V1158D probably benign Het
Dner A G 1: 84,383,938 F650S possibly damaging Het
Dnm3 T C 1: 162,307,893 N437S possibly damaging Het
Dpy19l2 A T 9: 24,584,632 C597S probably benign Het
Dpy19l2 T C 9: 24,680,780 I176V probably benign Het
Edf1 T C 2: 25,558,031 probably null Het
Enpp3 A G 10: 24,776,878 F727S probably damaging Het
Epb42 C T 2: 121,021,762 M583I probably benign Het
Foxred1 A G 9: 35,205,363 F117S probably damaging Het
Fstl5 T A 3: 76,708,065 M811K possibly damaging Het
Gm5117 A T 8: 31,738,194 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Grik1 G A 16: 88,056,124 A57V probably damaging Het
Hdgfl2 G A 17: 56,098,691 V476I possibly damaging Het
Il17b G T 18: 61,690,368 W91L probably damaging Het
Jph4 C A 14: 55,113,527 R344L probably benign Het
Map3k21 A G 8: 125,937,266 D522G probably benign Het
Mast2 A G 4: 116,322,283 L398S probably damaging Het
Mbtd1 A G 11: 93,910,388 T132A probably benign Het
Mbtps1 G T 8: 119,542,727 T208K probably benign Het
Mr1 A G 1: 155,146,630 probably null Het
Mthfsd G A 8: 121,101,501 L140F probably damaging Het
Mybpc2 C G 7: 44,509,845 D594H possibly damaging Het
Nalcn T C 14: 123,409,752 M570V probably benign Het
Ncam2 T C 16: 81,490,389 I397T probably damaging Het
Ndufs4 C T 13: 114,316,978 V75I probably damaging Het
Nek4 T A 14: 30,979,968 probably null Het
Nfatc1 G T 18: 80,635,845 A762D possibly damaging Het
Npc1 A G 18: 12,191,809 I1209T probably damaging Het
Olfr1206 A T 2: 88,864,869 N88I probably benign Het
Olfr370 T C 8: 83,541,621 I159T probably benign Het
Pak7 T C 2: 136,100,957 D421G probably damaging Het
Pias1 A G 9: 62,912,830 V285A possibly damaging Het
Pigg T A 5: 108,318,889 I212N probably damaging Het
Plcd3 A T 11: 103,071,148 C711S probably benign Het
Plscr5 G A 9: 92,198,497 R12K probably benign Het
Plxna4 T C 6: 32,516,974 I236V probably benign Het
Ppp1r26 T C 2: 28,452,358 F667L probably benign Het
Pqlc2 A T 4: 139,301,855 V106D probably damaging Het
Prkx A G X: 77,771,314 F247L probably benign Het
Qpct G A 17: 79,070,686 R95Q probably benign Het
Ralgapb G T 2: 158,437,472 M159I probably benign Het
Rnf145 T C 11: 44,555,170 L277P probably damaging Het
Scn9a A G 2: 66,536,325 S705P probably damaging Het
Slc4a8 A G 15: 100,806,373 T750A probably damaging Het
Syne2 A G 12: 76,094,456 E6114G probably damaging Het
Tat T C 8: 109,997,604 M375T probably damaging Het
Tex10 C T 4: 48,436,522 probably benign Het
Tmprss11e T C 5: 86,713,728 K320E probably benign Het
Tnr T C 1: 159,858,270 I357T probably damaging Het
Vmn1r229 A T 17: 20,815,376 R294S possibly damaging Het
Vmn2r116 G A 17: 23,401,469 D726N probably damaging Het
Vpreb2 T A 16: 17,981,070 L140* probably null Het
Wfs1 G A 5: 36,967,942 P535L probably damaging Het
Xdh A G 17: 73,922,537 L307P probably damaging Het
Zfp160 A G 17: 21,020,828 S53G probably benign Het
Zfp319 A G 8: 95,328,031 C515R probably damaging Het
Zfp747 A G 7: 127,375,757 F24L possibly damaging Het
Zzef1 A T 11: 72,848,634 probably benign Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
R7361:Actn1 UTSW 12 80193715 missense probably benign 0.01
R7452:Actn1 UTSW 12 80183602 missense probably benign 0.12
R7698:Actn1 UTSW 12 80174537 missense probably benign 0.00
R7701:Actn1 UTSW 12 80174554 missense possibly damaging 0.88
R8000:Actn1 UTSW 12 80199008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGCTACCCCAAATGGAGG -3'
(R):5'- ATGCAGCTTCCCTATCAAGG -3'

Sequencing Primer
(F):5'- CTACCCCAAATGGAGGCTAGG -3'
(R):5'- GGAACGTCCACGCTAAATAGCTTTC -3'
Posted On2014-10-01