Incidental Mutation 'R2157:Ncam2'
ID234946
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Nameneural cell adhesion molecule 2
SynonymsOcam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission 040160-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2157 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location81200697-81626828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81490389 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 397 (I397T)
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]
Predicted Effect probably damaging
Transcript: ENSMUST00000037785
AA Change: I397T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: I397T

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067602
AA Change: I397T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: I397T

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232550
Meta Mutation Damage Score 0.7919 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A T 8: 124,651,429 probably benign Het
4930590J08Rik A G 6: 91,917,698 probably null Het
4930590J08Rik T A 6: 91,942,487 M709K possibly damaging Het
A930011G23Rik T G 5: 99,232,097 I394L probably damaging Het
Abca13 A C 11: 9,577,170 M4528L probably damaging Het
Abcb1b G A 5: 8,824,791 A484T probably benign Het
Actn1 A T 12: 80,173,117 M660K probably benign Het
Adgra3 G T 5: 50,001,941 N322K possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Amotl2 A G 9: 102,730,589 probably benign Het
Apoa1 T C 9: 46,229,173 V34A probably damaging Het
Arrdc1 G A 2: 24,926,975 A113V probably damaging Het
As3mt A G 19: 46,707,792 D13G probably benign Het
C77080 C T 4: 129,224,124 R249H possibly damaging Het
Cald1 A G 6: 34,686,041 Q13R possibly damaging Het
Ccdc28a G A 10: 18,230,455 T41I probably benign Het
Ccdc30 A T 4: 119,333,724 probably benign Het
Cct2 T C 10: 117,062,809 probably benign Het
Cdh12 T C 15: 21,583,787 I571T possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Comp C T 8: 70,379,570 Q554* probably null Het
Csf2ra T C 19: 61,227,071 T70A probably benign Het
Csmd3 T C 15: 47,695,787 E2256G probably damaging Het
Dicer1 A T 12: 104,702,949 V1158D probably benign Het
Dner A G 1: 84,383,938 F650S possibly damaging Het
Dnm3 T C 1: 162,307,893 N437S possibly damaging Het
Dpy19l2 A T 9: 24,584,632 C597S probably benign Het
Dpy19l2 T C 9: 24,680,780 I176V probably benign Het
Edf1 T C 2: 25,558,031 probably null Het
Enpp3 A G 10: 24,776,878 F727S probably damaging Het
Epb42 C T 2: 121,021,762 M583I probably benign Het
Foxred1 A G 9: 35,205,363 F117S probably damaging Het
Fstl5 T A 3: 76,708,065 M811K possibly damaging Het
Gm5117 A T 8: 31,738,194 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Grik1 G A 16: 88,056,124 A57V probably damaging Het
Hdgfl2 G A 17: 56,098,691 V476I possibly damaging Het
Il17b G T 18: 61,690,368 W91L probably damaging Het
Jph4 C A 14: 55,113,527 R344L probably benign Het
Map3k21 A G 8: 125,937,266 D522G probably benign Het
Mast2 A G 4: 116,322,283 L398S probably damaging Het
Mbtd1 A G 11: 93,910,388 T132A probably benign Het
Mbtps1 G T 8: 119,542,727 T208K probably benign Het
Mr1 A G 1: 155,146,630 probably null Het
Mthfsd G A 8: 121,101,501 L140F probably damaging Het
Mybpc2 C G 7: 44,509,845 D594H possibly damaging Het
Nalcn T C 14: 123,409,752 M570V probably benign Het
Ndufs4 C T 13: 114,316,978 V75I probably damaging Het
Nek4 T A 14: 30,979,968 probably null Het
Nfatc1 G T 18: 80,635,845 A762D possibly damaging Het
Npc1 A G 18: 12,191,809 I1209T probably damaging Het
Olfr1206 A T 2: 88,864,869 N88I probably benign Het
Olfr370 T C 8: 83,541,621 I159T probably benign Het
Pak7 T C 2: 136,100,957 D421G probably damaging Het
Pias1 A G 9: 62,912,830 V285A possibly damaging Het
Pigg T A 5: 108,318,889 I212N probably damaging Het
Plcd3 A T 11: 103,071,148 C711S probably benign Het
Plscr5 G A 9: 92,198,497 R12K probably benign Het
Plxna4 T C 6: 32,516,974 I236V probably benign Het
Ppp1r26 T C 2: 28,452,358 F667L probably benign Het
Pqlc2 A T 4: 139,301,855 V106D probably damaging Het
Prkx A G X: 77,771,314 F247L probably benign Het
Qpct G A 17: 79,070,686 R95Q probably benign Het
Ralgapb G T 2: 158,437,472 M159I probably benign Het
Rnf145 T C 11: 44,555,170 L277P probably damaging Het
Scn9a A G 2: 66,536,325 S705P probably damaging Het
Slc4a8 A G 15: 100,806,373 T750A probably damaging Het
Syne2 A G 12: 76,094,456 E6114G probably damaging Het
Tat T C 8: 109,997,604 M375T probably damaging Het
Tex10 C T 4: 48,436,522 probably benign Het
Tmprss11e T C 5: 86,713,728 K320E probably benign Het
Tnr T C 1: 159,858,270 I357T probably damaging Het
Vmn1r229 A T 17: 20,815,376 R294S possibly damaging Het
Vmn2r116 G A 17: 23,401,469 D726N probably damaging Het
Vpreb2 T A 16: 17,981,070 L140* probably null Het
Wfs1 G A 5: 36,967,942 P535L probably damaging Het
Xdh A G 17: 73,922,537 L307P probably damaging Het
Zfp160 A G 17: 21,020,828 S53G probably benign Het
Zfp319 A G 8: 95,328,031 C515R probably damaging Het
Zfp747 A G 7: 127,375,757 F24L possibly damaging Het
Zzef1 A T 11: 72,848,634 probably benign Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
BB009:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
BB019:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0097:Ncam2 UTSW 16 81517537 missense probably damaging 1.00
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1646:Ncam2 UTSW 16 81465706 critical splice donor site probably benign
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5526:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6050:Ncam2 UTSW 16 81443166 nonsense probably null
R6212:Ncam2 UTSW 16 81432762 missense probably damaging 1.00
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
R7568:Ncam2 UTSW 16 81589801 missense probably benign 0.19
R7686:Ncam2 UTSW 16 81621454 missense probably damaging 0.99
R7759:Ncam2 UTSW 16 81615784 missense probably damaging 1.00
R7848:Ncam2 UTSW 16 81490379 missense probably benign
R7932:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R8078:Ncam2 UTSW 16 81443248 missense possibly damaging 0.60
R8287:Ncam2 UTSW 16 81526995 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TAACACGATGAATTTGGGGACTG -3'
(R):5'- AGGAACTCTGGGAATTGACTG -3'

Sequencing Primer
(F):5'- TTTTTCATCATCACAAGAAATCGCCC -3'
(R):5'- GAACTCTGGGAATTGACTGAATTG -3'
Posted On2014-10-01