Incidental Mutation 'R2157:Ahnak'
ID234957
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene NameAHNAK nucleoprotein (desmoyokin)
Synonyms1110004P15Rik, 2310047C17Rik, DY6
MMRRC Submission 040160-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R2157 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8989284-9076919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9000684 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 56 (I56V)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092955
AA Change: I56V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833
AA Change: I56V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092956
AA Change: I56V

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: I56V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A T 8: 124,651,429 probably benign Het
4930590J08Rik A G 6: 91,917,698 probably null Het
4930590J08Rik T A 6: 91,942,487 M709K possibly damaging Het
A930011G23Rik T G 5: 99,232,097 I394L probably damaging Het
Abca13 A C 11: 9,577,170 M4528L probably damaging Het
Abcb1b G A 5: 8,824,791 A484T probably benign Het
Actn1 A T 12: 80,173,117 M660K probably benign Het
Adgra3 G T 5: 50,001,941 N322K possibly damaging Het
Amotl2 A G 9: 102,730,589 probably benign Het
Apoa1 T C 9: 46,229,173 V34A probably damaging Het
Arrdc1 G A 2: 24,926,975 A113V probably damaging Het
As3mt A G 19: 46,707,792 D13G probably benign Het
C77080 C T 4: 129,224,124 R249H possibly damaging Het
Cald1 A G 6: 34,686,041 Q13R possibly damaging Het
Ccdc28a G A 10: 18,230,455 T41I probably benign Het
Ccdc30 A T 4: 119,333,724 probably benign Het
Cct2 T C 10: 117,062,809 probably benign Het
Cdh12 T C 15: 21,583,787 I571T possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Comp C T 8: 70,379,570 Q554* probably null Het
Csf2ra T C 19: 61,227,071 T70A probably benign Het
Csmd3 T C 15: 47,695,787 E2256G probably damaging Het
Dicer1 A T 12: 104,702,949 V1158D probably benign Het
Dner A G 1: 84,383,938 F650S possibly damaging Het
Dnm3 T C 1: 162,307,893 N437S possibly damaging Het
Dpy19l2 A T 9: 24,584,632 C597S probably benign Het
Dpy19l2 T C 9: 24,680,780 I176V probably benign Het
Edf1 T C 2: 25,558,031 probably null Het
Enpp3 A G 10: 24,776,878 F727S probably damaging Het
Epb42 C T 2: 121,021,762 M583I probably benign Het
Foxred1 A G 9: 35,205,363 F117S probably damaging Het
Fstl5 T A 3: 76,708,065 M811K possibly damaging Het
Gm5117 A T 8: 31,738,194 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
Grik1 G A 16: 88,056,124 A57V probably damaging Het
Hdgfl2 G A 17: 56,098,691 V476I possibly damaging Het
Il17b G T 18: 61,690,368 W91L probably damaging Het
Jph4 C A 14: 55,113,527 R344L probably benign Het
Map3k21 A G 8: 125,937,266 D522G probably benign Het
Mast2 A G 4: 116,322,283 L398S probably damaging Het
Mbtd1 A G 11: 93,910,388 T132A probably benign Het
Mbtps1 G T 8: 119,542,727 T208K probably benign Het
Mr1 A G 1: 155,146,630 probably null Het
Mthfsd G A 8: 121,101,501 L140F probably damaging Het
Mybpc2 C G 7: 44,509,845 D594H possibly damaging Het
Nalcn T C 14: 123,409,752 M570V probably benign Het
Ncam2 T C 16: 81,490,389 I397T probably damaging Het
Ndufs4 C T 13: 114,316,978 V75I probably damaging Het
Nek4 T A 14: 30,979,968 probably null Het
Nfatc1 G T 18: 80,635,845 A762D possibly damaging Het
Npc1 A G 18: 12,191,809 I1209T probably damaging Het
Olfr1206 A T 2: 88,864,869 N88I probably benign Het
Olfr370 T C 8: 83,541,621 I159T probably benign Het
Pak7 T C 2: 136,100,957 D421G probably damaging Het
Pias1 A G 9: 62,912,830 V285A possibly damaging Het
Pigg T A 5: 108,318,889 I212N probably damaging Het
Plcd3 A T 11: 103,071,148 C711S probably benign Het
Plscr5 G A 9: 92,198,497 R12K probably benign Het
Plxna4 T C 6: 32,516,974 I236V probably benign Het
Ppp1r26 T C 2: 28,452,358 F667L probably benign Het
Pqlc2 A T 4: 139,301,855 V106D probably damaging Het
Prkx A G X: 77,771,314 F247L probably benign Het
Qpct G A 17: 79,070,686 R95Q probably benign Het
Ralgapb G T 2: 158,437,472 M159I probably benign Het
Rnf145 T C 11: 44,555,170 L277P probably damaging Het
Scn9a A G 2: 66,536,325 S705P probably damaging Het
Slc4a8 A G 15: 100,806,373 T750A probably damaging Het
Syne2 A G 12: 76,094,456 E6114G probably damaging Het
Tat T C 8: 109,997,604 M375T probably damaging Het
Tex10 C T 4: 48,436,522 probably benign Het
Tmprss11e T C 5: 86,713,728 K320E probably benign Het
Tnr T C 1: 159,858,270 I357T probably damaging Het
Vmn1r229 A T 17: 20,815,376 R294S possibly damaging Het
Vmn2r116 G A 17: 23,401,469 D726N probably damaging Het
Vpreb2 T A 16: 17,981,070 L140* probably null Het
Wfs1 G A 5: 36,967,942 P535L probably damaging Het
Xdh A G 17: 73,922,537 L307P probably damaging Het
Zfp160 A G 17: 21,020,828 S53G probably benign Het
Zfp319 A G 8: 95,328,031 C515R probably damaging Het
Zfp747 A G 7: 127,375,757 F24L possibly damaging Het
Zzef1 A T 11: 72,848,634 probably benign Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
Nanook UTSW 19 9003231 missense probably benign 0.42
Netsilik UTSW 19 9002321 missense probably benign 0.00
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 9006176 missense possibly damaging 0.87
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1913:Ahnak UTSW 19 9007922 missense probably damaging 0.99
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5396:Ahnak UTSW 19 9007175 missense probably damaging 0.99
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5644:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R5988:Ahnak UTSW 19 9009347 intron probably benign
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6255:Ahnak UTSW 19 9008025 missense possibly damaging 0.95
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6296:Ahnak UTSW 19 9003305 missense probably damaging 0.99
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6590:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
R7126:Ahnak UTSW 19 9002359 missense possibly damaging 0.61
R7181:Ahnak UTSW 19 9013488 missense probably damaging 1.00
R7183:Ahnak UTSW 19 9017668 missense probably damaging 1.00
R7202:Ahnak UTSW 19 9017799 missense probably damaging 1.00
R7235:Ahnak UTSW 19 9012488 missense unknown
R7241:Ahnak UTSW 19 9009031 missense possibly damaging 0.65
R7269:Ahnak UTSW 19 9006617 missense probably damaging 1.00
R7311:Ahnak UTSW 19 9002143 missense probably benign 0.04
R7311:Ahnak UTSW 19 9009827 missense possibly damaging 0.56
R7329:Ahnak UTSW 19 9001792 missense probably damaging 0.99
R7339:Ahnak UTSW 19 9008165 missense possibly damaging 0.75
R7390:Ahnak UTSW 19 9003205 missense probably benign 0.02
R7400:Ahnak UTSW 19 9014613 missense probably damaging 0.99
R7444:Ahnak UTSW 19 9007423 missense probably benign 0.08
R7483:Ahnak UTSW 19 9004822 missense probably damaging 1.00
R7498:Ahnak UTSW 19 9012019 missense probably benign 0.14
R7521:Ahnak UTSW 19 9002351 missense possibly damaging 0.89
R7522:Ahnak UTSW 19 9002322 missense probably benign 0.01
R7552:Ahnak UTSW 19 9006824 missense probably benign 0.18
R7563:Ahnak UTSW 19 9011165 missense probably damaging 0.99
R7565:Ahnak UTSW 19 9016156 missense probably benign 0.05
R7571:Ahnak UTSW 19 9000786 nonsense probably null
R7583:Ahnak UTSW 19 9006093 missense possibly damaging 0.90
R7600:Ahnak UTSW 19 9004574 missense possibly damaging 0.89
R7771:Ahnak UTSW 19 9015047 missense probably damaging 0.99
R7787:Ahnak UTSW 19 9009315 missense unknown
R7827:Ahnak UTSW 19 9005344 nonsense probably null
R7857:Ahnak UTSW 19 9007468 missense probably damaging 0.97
R7916:Ahnak UTSW 19 9005832 missense possibly damaging 0.66
R7939:Ahnak UTSW 19 9014084 nonsense probably null
R7959:Ahnak UTSW 19 9010649 missense possibly damaging 0.46
R7962:Ahnak UTSW 19 9012800 missense unknown
R7979:Ahnak UTSW 19 9011432 missense probably damaging 1.00
R8006:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R8013:Ahnak UTSW 19 9009335 missense unknown
R8033:Ahnak UTSW 19 9003710 missense probably benign 0.10
R8124:Ahnak UTSW 19 9007123 missense probably damaging 0.99
R8125:Ahnak UTSW 19 9011876 missense possibly damaging 0.95
R8129:Ahnak UTSW 19 9000100 start codon destroyed not run
R8151:Ahnak UTSW 19 9004679 missense possibly damaging 0.59
R8190:Ahnak UTSW 19 9002255 missense probably benign 0.01
R8221:Ahnak UTSW 19 9010436 nonsense probably null
R8241:Ahnak UTSW 19 9007295 missense probably benign 0.15
R8244:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8248:Ahnak UTSW 19 9001946 missense probably damaging 1.00
R8261:Ahnak UTSW 19 9005453 missense probably damaging 1.00
R8330:Ahnak UTSW 19 9009662 missense possibly damaging 0.86
R8380:Ahnak UTSW 19 9017855 missense probably benign 0.05
R8407:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8409:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8511:Ahnak UTSW 19 9012355 missense unknown
RF007:Ahnak UTSW 19 9013601 missense possibly damaging 0.45
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Z1176:Ahnak UTSW 19 9008856 missense probably damaging 0.97
Z1177:Ahnak UTSW 19 9017468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGTCTTGGATACCGACTG -3'
(R):5'- TTCAGAGCTACGGGAACTGAAG -3'

Sequencing Primer
(F):5'- GCAGCTATGTGTAAAATAGTTGGCC -3'
(R):5'- AAGACTTCATGGGTCCAGGTC -3'
Posted On2014-10-01