Mutagenetix > Incidental Mutations

Incidental Mutation 'R2158:Strc'

234969

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

040161-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R2158 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121365862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1562 (I1562V)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000126130] [ENSMUST00000129136] [ENSMUST00000150271]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000000317

SMART Domains

Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	58	133	5.8e-34	PFAM
Pfam:ATP-gua_Ptrans	154	401	4.5e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: I1562V

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: I1562V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000078222

SMART Domains

Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	1.2e-37	PFAM
Pfam:ATP-gua_Ptrans	154	401	2e-105	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126130

SMART Domains

Protein: ENSMUSP00000117463
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
low complexity region	39	54	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150271

SMART Domains

Protein: ENSMUSP00000120507
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	3.3e-38	PFAM
Pfam:ATP-gua_Ptrans	154	251	3.8e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153040

Meta Mutation Damage Score

0.1530

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	T	C	19: 3,716,608	V65A	possibly damaging	Het
4930402F06Rik	A	T	2: 35,385,668	S38T	possibly damaging	Het
Adam4	A	G	12: 81,421,763	L28S	probably damaging	Het
Agmo	T	A	12: 37,357,710	F198I	probably damaging	Het
Akap7	A	G	10: 25,171,164	V45A	probably damaging	Het
Amotl1	G	T	9: 14,575,169	N476K	probably benign	Het
Apcs	A	G	1: 172,894,533	L82P	probably damaging	Het
Armc3	C	A	2: 19,248,633	P195Q	probably damaging	Het
Astn2	A	T	4: 66,404,254	L36Q	unknown	Het
Atad2	A	T	15: 58,098,566	S870T	possibly damaging	Het
Bmp10	A	T	6: 87,434,080	D285V	probably benign	Het
Caskin1	T	C	17: 24,505,154	V972A	probably benign	Het
Ccdc141	T	A	2: 77,030,671	N921Y	probably damaging	Het
Cntnap5b	A	T	1: 100,390,572	D1019V	probably damaging	Het
Eml5	T	C	12: 98,843,946		probably benign	Het
Evi5l	T	C	8: 4,193,195	Y360H	probably damaging	Het
Ewsr1	A	G	11: 5,091,450		probably benign	Het
Fn3k	A	T	11: 121,448,886	N158I	probably damaging	Het
Galnt17	C	T	5: 130,906,702	R381Q	probably damaging	Het
Golga3	A	T	5: 110,187,361	K180N	probably damaging	Het
Hipk1	A	G	3: 103,760,538	L571P	probably damaging	Het
Hormad2	T	A	11: 4,424,808	K69*	probably null	Het
Hspg2	A	T	4: 137,517,604	D880V	probably damaging	Het
Ido2	T	A	8: 24,540,636	D226V	probably damaging	Het
Irs3	A	G	5: 137,644,699	F159S	probably damaging	Het
Itgb1bp1	T	C	12: 21,276,859	T38A	probably damaging	Het
Kif11	A	G	19: 37,410,614	I749V	probably benign	Het
Lrp1b	T	G	2: 40,879,555	M2811L	probably benign	Het
Lysmd3	A	G	13: 81,669,618	Y238C	probably damaging	Het
Mapk11	G	A	15: 89,146,372	T106M	probably damaging	Het
Mdga2	C	T	12: 66,689,381	V358I	possibly damaging	Het
Muc4	C	T	16: 32,754,563	T1479I	probably benign	Het
Myom1	T	C	17: 71,064,597	V578A	possibly damaging	Het
Nek10	T	G	14: 14,885,047		probably null	Het
Nid2	G	A	14: 19,778,043	G516S	probably benign	Het
Olfr328	T	A	11: 58,551,942	Q99L	probably damaging	Het
Olfr620	G	C	7: 103,612,236	T39R	possibly damaging	Het
Olfr645	T	G	7: 104,084,826	T85P	probably benign	Het
Olfr69	G	T	7: 103,767,961	C145*	probably null	Het
Olfr728	T	A	14: 50,140,123	N172I	probably damaging	Het
Olfr930	T	C	9: 38,930,579	M136T	probably damaging	Het
Pde4dip	A	T	3: 97,757,621	C333S	probably benign	Het
Pglyrp2	T	A	17: 32,418,248	I269F	probably benign	Het
Plch1	A	G	3: 63,721,234	V536A	probably benign	Het
Popdc2	T	A	16: 38,362,826	L57Q	probably damaging	Het
Pramef17	T	C	4: 143,994,315	R19G	possibly damaging	Het
Riox1	A	G	12: 83,950,935	K82E	probably benign	Het
Rnasel	G	A	1: 153,754,901	V388M	probably damaging	Het
Smc1b	A	G	15: 85,121,851		probably benign	Het
Snx25	A	G	8: 46,041,407	S814P	probably damaging	Het
Spta1	A	T	1: 174,229,258	H1859L	probably benign	Het
Taar5	T	A	10: 23,971,088	I128N	probably damaging	Het
Ttc28	C	T	5: 111,177,617		probably benign	Het
Vcan	A	T	13: 89,703,529	M1104K	possibly damaging	Het
Vnn1	C	T	10: 23,900,755	Q335*	probably null	Het
Zic1	T	C	9: 91,364,893	D42G	possibly damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGCATGAGAAAATCCCTTGG -3'
(R):5'- CAGCCTTTCAGTAACCCCTG -3'

Sequencing Primer
(F):5'- CATGAGAAAATCCCTTGGGTCTG -3'
(R):5'- TTCAGTAACCCCTGAATCAGAG -3'

Posted On

2014-10-01