Incidental Mutation 'R2158:Bmp10'
ID234980
Institutional Source Beutler Lab
Gene Symbol Bmp10
Ensembl Gene ENSMUSG00000030046
Gene Namebone morphogenetic protein 10
Synonyms
MMRRC Submission 040161-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2158 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87428994-87437677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87434080 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 285 (D285V)
Ref Sequence ENSEMBL: ENSMUSP00000032125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032125]
Predicted Effect probably benign
Transcript: ENSMUST00000032125
AA Change: D285V

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046
AA Change: D285V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 52 256 8.1e-24 PFAM
TGFB 320 420 6.7e-52 SMART
Meta Mutation Damage Score 0.0940 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,716,608 V65A possibly damaging Het
4930402F06Rik A T 2: 35,385,668 S38T possibly damaging Het
Adam4 A G 12: 81,421,763 L28S probably damaging Het
Agmo T A 12: 37,357,710 F198I probably damaging Het
Akap7 A G 10: 25,171,164 V45A probably damaging Het
Amotl1 G T 9: 14,575,169 N476K probably benign Het
Apcs A G 1: 172,894,533 L82P probably damaging Het
Armc3 C A 2: 19,248,633 P195Q probably damaging Het
Astn2 A T 4: 66,404,254 L36Q unknown Het
Atad2 A T 15: 58,098,566 S870T possibly damaging Het
Caskin1 T C 17: 24,505,154 V972A probably benign Het
Ccdc141 T A 2: 77,030,671 N921Y probably damaging Het
Cntnap5b A T 1: 100,390,572 D1019V probably damaging Het
Eml5 T C 12: 98,843,946 probably benign Het
Evi5l T C 8: 4,193,195 Y360H probably damaging Het
Ewsr1 A G 11: 5,091,450 probably benign Het
Fn3k A T 11: 121,448,886 N158I probably damaging Het
Galnt17 C T 5: 130,906,702 R381Q probably damaging Het
Golga3 A T 5: 110,187,361 K180N probably damaging Het
Hipk1 A G 3: 103,760,538 L571P probably damaging Het
Hormad2 T A 11: 4,424,808 K69* probably null Het
Hspg2 A T 4: 137,517,604 D880V probably damaging Het
Ido2 T A 8: 24,540,636 D226V probably damaging Het
Irs3 A G 5: 137,644,699 F159S probably damaging Het
Itgb1bp1 T C 12: 21,276,859 T38A probably damaging Het
Kif11 A G 19: 37,410,614 I749V probably benign Het
Lrp1b T G 2: 40,879,555 M2811L probably benign Het
Lysmd3 A G 13: 81,669,618 Y238C probably damaging Het
Mapk11 G A 15: 89,146,372 T106M probably damaging Het
Mdga2 C T 12: 66,689,381 V358I possibly damaging Het
Muc4 C T 16: 32,754,563 T1479I probably benign Het
Myom1 T C 17: 71,064,597 V578A possibly damaging Het
Nek10 T G 14: 14,885,047 probably null Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr328 T A 11: 58,551,942 Q99L probably damaging Het
Olfr620 G C 7: 103,612,236 T39R possibly damaging Het
Olfr645 T G 7: 104,084,826 T85P probably benign Het
Olfr69 G T 7: 103,767,961 C145* probably null Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr930 T C 9: 38,930,579 M136T probably damaging Het
Pde4dip A T 3: 97,757,621 C333S probably benign Het
Pglyrp2 T A 17: 32,418,248 I269F probably benign Het
Plch1 A G 3: 63,721,234 V536A probably benign Het
Popdc2 T A 16: 38,362,826 L57Q probably damaging Het
Pramef17 T C 4: 143,994,315 R19G possibly damaging Het
Riox1 A G 12: 83,950,935 K82E probably benign Het
Rnasel G A 1: 153,754,901 V388M probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Snx25 A G 8: 46,041,407 S814P probably damaging Het
Spta1 A T 1: 174,229,258 H1859L probably benign Het
Strc T C 2: 121,365,862 I1562V probably benign Het
Taar5 T A 10: 23,971,088 I128N probably damaging Het
Ttc28 C T 5: 111,177,617 probably benign Het
Vcan A T 13: 89,703,529 M1104K possibly damaging Het
Vnn1 C T 10: 23,900,755 Q335* probably null Het
Zic1 T C 9: 91,364,893 D42G possibly damaging Het
Other mutations in Bmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Bmp10 APN 6 87429160 missense possibly damaging 0.87
IGL00946:Bmp10 APN 6 87434362 missense probably damaging 1.00
IGL01483:Bmp10 APN 6 87433951 missense probably damaging 1.00
IGL02132:Bmp10 APN 6 87434148 missense probably benign
R1391:Bmp10 UTSW 6 87433758 missense probably benign 0.00
R1472:Bmp10 UTSW 6 87433797 missense probably benign 0.34
R1938:Bmp10 UTSW 6 87433720 missense possibly damaging 0.77
R2114:Bmp10 UTSW 6 87434459 missense probably benign 0.10
R4922:Bmp10 UTSW 6 87433575 missense probably benign 0.00
R5042:Bmp10 UTSW 6 87434057 missense probably damaging 0.98
R6041:Bmp10 UTSW 6 87434320 missense probably damaging 1.00
R7000:Bmp10 UTSW 6 87434193 missense probably benign 0.02
R7593:Bmp10 UTSW 6 87433669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTGGCAAAAGTCAGGC -3'
(R):5'- TAGGCTTCATACCCAGGAGG -3'

Sequencing Primer
(F):5'- CATCAGCTGGAGATCCACATAG -3'
(R):5'- CTTCATACCCAGGAGGAGCGATG -3'
Posted On2014-10-01