Incidental Mutation 'R2158:Riox1'
ID235003
Institutional Source Beutler Lab
Gene Symbol Riox1
Ensembl Gene ENSMUSG00000046791
Gene Nameribosomal oxygenase 1
SynonymsNO66, 2410016O06Rik
MMRRC Submission 040161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R2158 (G1)
Quality Score96
Status Validated
Chromosome12
Chromosomal Location83950608-83952951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83950935 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 82 (K82E)
Ref Sequence ENSEMBL: ENSMUSP00000057984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053744] [ENSMUST00000164935]
Predicted Effect probably benign
Transcript: ENSMUST00000053744
AA Change: K82E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057984
Gene: ENSMUSG00000046791
AA Change: K82E

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
JmjC 266 394 5.07e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164935
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181399
SMART Domains Protein: ENSMUSP00000137697
Gene: ENSMUSG00000096953

DomainStartEndE-ValueType
low complexity region 1 19 N/A INTRINSIC
low complexity region 27 40 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
low complexity region 117 161 N/A INTRINSIC
low complexity region 171 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223215
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele activated in mesenchyme exhibit increased body length and weight, increased ossification with increased bone mass, bone mineral density, and volume, increased osteoblasts; and decrease osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,716,608 V65A possibly damaging Het
4930402F06Rik A T 2: 35,385,668 S38T possibly damaging Het
Adam4 A G 12: 81,421,763 L28S probably damaging Het
Agmo T A 12: 37,357,710 F198I probably damaging Het
Akap7 A G 10: 25,171,164 V45A probably damaging Het
Amotl1 G T 9: 14,575,169 N476K probably benign Het
Apcs A G 1: 172,894,533 L82P probably damaging Het
Armc3 C A 2: 19,248,633 P195Q probably damaging Het
Astn2 A T 4: 66,404,254 L36Q unknown Het
Atad2 A T 15: 58,098,566 S870T possibly damaging Het
Bmp10 A T 6: 87,434,080 D285V probably benign Het
Caskin1 T C 17: 24,505,154 V972A probably benign Het
Ccdc141 T A 2: 77,030,671 N921Y probably damaging Het
Cntnap5b A T 1: 100,390,572 D1019V probably damaging Het
Eml5 T C 12: 98,843,946 probably benign Het
Evi5l T C 8: 4,193,195 Y360H probably damaging Het
Ewsr1 A G 11: 5,091,450 probably benign Het
Fn3k A T 11: 121,448,886 N158I probably damaging Het
Galnt17 C T 5: 130,906,702 R381Q probably damaging Het
Golga3 A T 5: 110,187,361 K180N probably damaging Het
Hipk1 A G 3: 103,760,538 L571P probably damaging Het
Hormad2 T A 11: 4,424,808 K69* probably null Het
Hspg2 A T 4: 137,517,604 D880V probably damaging Het
Ido2 T A 8: 24,540,636 D226V probably damaging Het
Irs3 A G 5: 137,644,699 F159S probably damaging Het
Itgb1bp1 T C 12: 21,276,859 T38A probably damaging Het
Kif11 A G 19: 37,410,614 I749V probably benign Het
Lrp1b T G 2: 40,879,555 M2811L probably benign Het
Lysmd3 A G 13: 81,669,618 Y238C probably damaging Het
Mapk11 G A 15: 89,146,372 T106M probably damaging Het
Mdga2 C T 12: 66,689,381 V358I possibly damaging Het
Muc4 C T 16: 32,754,563 T1479I probably benign Het
Myom1 T C 17: 71,064,597 V578A possibly damaging Het
Nek10 T G 14: 14,885,047 probably null Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr328 T A 11: 58,551,942 Q99L probably damaging Het
Olfr620 G C 7: 103,612,236 T39R possibly damaging Het
Olfr645 T G 7: 104,084,826 T85P probably benign Het
Olfr69 G T 7: 103,767,961 C145* probably null Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr930 T C 9: 38,930,579 M136T probably damaging Het
Pde4dip A T 3: 97,757,621 C333S probably benign Het
Pglyrp2 T A 17: 32,418,248 I269F probably benign Het
Plch1 A G 3: 63,721,234 V536A probably benign Het
Popdc2 T A 16: 38,362,826 L57Q probably damaging Het
Pramef17 T C 4: 143,994,315 R19G possibly damaging Het
Rnasel G A 1: 153,754,901 V388M probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Snx25 A G 8: 46,041,407 S814P probably damaging Het
Spta1 A T 1: 174,229,258 H1859L probably benign Het
Strc T C 2: 121,365,862 I1562V probably benign Het
Taar5 T A 10: 23,971,088 I128N probably damaging Het
Ttc28 C T 5: 111,177,617 probably benign Het
Vcan A T 13: 89,703,529 M1104K possibly damaging Het
Vnn1 C T 10: 23,900,755 Q335* probably null Het
Zic1 T C 9: 91,364,893 D42G possibly damaging Het
Other mutations in Riox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Riox1 APN 12 83951794 missense probably damaging 1.00
R1968:Riox1 UTSW 12 83951382 missense probably damaging 1.00
R2395:Riox1 UTSW 12 83950644 start gained probably null
R5691:Riox1 UTSW 12 83951692 missense possibly damaging 0.54
R6396:Riox1 UTSW 12 83951313 missense possibly damaging 0.88
R6968:Riox1 UTSW 12 83951373 missense probably damaging 0.98
R7322:Riox1 UTSW 12 83950668 unclassified probably benign
R7520:Riox1 UTSW 12 83951771 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGACGAGCTACCGAATG -3'
(R):5'- TTCAGCTCCGTCAGTACCTG -3'

Sequencing Primer
(F):5'- CGAGCTACCGAATGGCAACG -3'
(R):5'- TCCGTCAGTACCTGCTGCAG -3'
Posted On2014-10-01