Incidental Mutation 'R2158:Atad2'
ID235011
Institutional Source Beutler Lab
Gene Symbol Atad2
Ensembl Gene ENSMUSG00000022360
Gene NameATPase family, AAA domain containing 2
Synonyms2610509G12Rik
MMRRC Submission 040161-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R2158 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58094044-58135082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58098566 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 870 (S870T)
Ref Sequence ENSEMBL: ENSMUSP00000153936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]
Predicted Effect probably benign
Transcript: ENSMUST00000038194
AA Change: S1194T

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: S1194T

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
low complexity region 237 268 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
AAA 438 579 9.93e-21 SMART
low complexity region 622 633 N/A INTRINSIC
SCOP:d1e32a2 751 912 5e-4 SMART
low complexity region 924 947 N/A INTRINSIC
BROMO 955 1067 1.2e-19 SMART
low complexity region 1213 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226649
Predicted Effect possibly damaging
Transcript: ENSMUST00000228783
AA Change: S870T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T C 19: 3,716,608 V65A possibly damaging Het
4930402F06Rik A T 2: 35,385,668 S38T possibly damaging Het
Adam4 A G 12: 81,421,763 L28S probably damaging Het
Agmo T A 12: 37,357,710 F198I probably damaging Het
Akap7 A G 10: 25,171,164 V45A probably damaging Het
Amotl1 G T 9: 14,575,169 N476K probably benign Het
Apcs A G 1: 172,894,533 L82P probably damaging Het
Armc3 C A 2: 19,248,633 P195Q probably damaging Het
Astn2 A T 4: 66,404,254 L36Q unknown Het
Bmp10 A T 6: 87,434,080 D285V probably benign Het
Caskin1 T C 17: 24,505,154 V972A probably benign Het
Ccdc141 T A 2: 77,030,671 N921Y probably damaging Het
Cntnap5b A T 1: 100,390,572 D1019V probably damaging Het
Eml5 T C 12: 98,843,946 probably benign Het
Evi5l T C 8: 4,193,195 Y360H probably damaging Het
Ewsr1 A G 11: 5,091,450 probably benign Het
Fn3k A T 11: 121,448,886 N158I probably damaging Het
Galnt17 C T 5: 130,906,702 R381Q probably damaging Het
Golga3 A T 5: 110,187,361 K180N probably damaging Het
Hipk1 A G 3: 103,760,538 L571P probably damaging Het
Hormad2 T A 11: 4,424,808 K69* probably null Het
Hspg2 A T 4: 137,517,604 D880V probably damaging Het
Ido2 T A 8: 24,540,636 D226V probably damaging Het
Irs3 A G 5: 137,644,699 F159S probably damaging Het
Itgb1bp1 T C 12: 21,276,859 T38A probably damaging Het
Kif11 A G 19: 37,410,614 I749V probably benign Het
Lrp1b T G 2: 40,879,555 M2811L probably benign Het
Lysmd3 A G 13: 81,669,618 Y238C probably damaging Het
Mapk11 G A 15: 89,146,372 T106M probably damaging Het
Mdga2 C T 12: 66,689,381 V358I possibly damaging Het
Muc4 C T 16: 32,754,563 T1479I probably benign Het
Myom1 T C 17: 71,064,597 V578A possibly damaging Het
Nek10 T G 14: 14,885,047 probably null Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr328 T A 11: 58,551,942 Q99L probably damaging Het
Olfr620 G C 7: 103,612,236 T39R possibly damaging Het
Olfr645 T G 7: 104,084,826 T85P probably benign Het
Olfr69 G T 7: 103,767,961 C145* probably null Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr930 T C 9: 38,930,579 M136T probably damaging Het
Pde4dip A T 3: 97,757,621 C333S probably benign Het
Pglyrp2 T A 17: 32,418,248 I269F probably benign Het
Plch1 A G 3: 63,721,234 V536A probably benign Het
Popdc2 T A 16: 38,362,826 L57Q probably damaging Het
Pramef17 T C 4: 143,994,315 R19G possibly damaging Het
Riox1 A G 12: 83,950,935 K82E probably benign Het
Rnasel G A 1: 153,754,901 V388M probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Snx25 A G 8: 46,041,407 S814P probably damaging Het
Spta1 A T 1: 174,229,258 H1859L probably benign Het
Strc T C 2: 121,365,862 I1562V probably benign Het
Taar5 T A 10: 23,971,088 I128N probably damaging Het
Ttc28 C T 5: 111,177,617 probably benign Het
Vcan A T 13: 89,703,529 M1104K possibly damaging Het
Vnn1 C T 10: 23,900,755 Q335* probably null Het
Zic1 T C 9: 91,364,893 D42G possibly damaging Het
Other mutations in Atad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Atad2 APN 15 58116820 missense probably damaging 1.00
IGL00556:Atad2 APN 15 58100080 missense probably damaging 1.00
IGL00674:Atad2 APN 15 58108386 missense possibly damaging 0.49
IGL01407:Atad2 APN 15 58104525 missense probably benign
IGL02557:Atad2 APN 15 58122597 missense probably benign 0.04
IGL03060:Atad2 APN 15 58122446 unclassified probably benign
IGL03308:Atad2 APN 15 58102523 missense probably benign 0.00
R0113:Atad2 UTSW 15 58120934 unclassified probably benign
R0195:Atad2 UTSW 15 58099954 splice site probably benign
R0310:Atad2 UTSW 15 58114257 missense probably damaging 1.00
R0499:Atad2 UTSW 15 58103240 missense possibly damaging 0.92
R0499:Atad2 UTSW 15 58120949 missense probably benign
R0564:Atad2 UTSW 15 58125833 splice site probably benign
R0578:Atad2 UTSW 15 58105568 missense probably damaging 1.00
R0581:Atad2 UTSW 15 58126664 missense probably benign
R0667:Atad2 UTSW 15 58098719 missense probably benign 0.01
R0697:Atad2 UTSW 15 58105543 missense possibly damaging 0.91
R1219:Atad2 UTSW 15 58134911 missense probably benign 0.00
R1271:Atad2 UTSW 15 58126589 missense probably benign 0.00
R1544:Atad2 UTSW 15 58103364 missense probably damaging 1.00
R1624:Atad2 UTSW 15 58100019 missense probably damaging 1.00
R1853:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1854:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1855:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1860:Atad2 UTSW 15 58096718 splice site probably null
R1861:Atad2 UTSW 15 58096718 splice site probably null
R1876:Atad2 UTSW 15 58106868 missense probably benign 0.00
R1938:Atad2 UTSW 15 58096705 missense possibly damaging 0.76
R3756:Atad2 UTSW 15 58099723 missense probably benign 0.01
R4256:Atad2 UTSW 15 58116856 missense probably damaging 1.00
R4762:Atad2 UTSW 15 58108362 missense probably benign
R4827:Atad2 UTSW 15 58108348 missense probably benign 0.07
R4838:Atad2 UTSW 15 58103283 missense probably damaging 1.00
R5238:Atad2 UTSW 15 58108337 missense possibly damaging 0.90
R5247:Atad2 UTSW 15 58104478 nonsense probably null
R5685:Atad2 UTSW 15 58116798 missense possibly damaging 0.95
R5790:Atad2 UTSW 15 58126594 missense probably damaging 1.00
R5813:Atad2 UTSW 15 58099854 missense probably benign 0.42
R5886:Atad2 UTSW 15 58098514 nonsense probably null
R5955:Atad2 UTSW 15 58105659 missense probably benign 0.06
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6111:Atad2 UTSW 15 58108091 missense probably benign 0.07
R6209:Atad2 UTSW 15 58118415 missense probably damaging 1.00
R6587:Atad2 UTSW 15 58121048 missense probably benign 0.03
R6856:Atad2 UTSW 15 58106813 missense probably damaging 1.00
R7106:Atad2 UTSW 15 58116766 critical splice donor site probably null
R7178:Atad2 UTSW 15 58117293 missense probably damaging 1.00
R7290:Atad2 UTSW 15 58098651 missense probably benign 0.00
R7421:Atad2 UTSW 15 58134926 missense probably benign 0.40
R7583:Atad2 UTSW 15 58126664 missense probably benign
R7861:Atad2 UTSW 15 58125780 missense probably benign 0.10
R7886:Atad2 UTSW 15 58126136 missense probably damaging 1.00
R8072:Atad2 UTSW 15 58099978 missense possibly damaging 0.96
R8126:Atad2 UTSW 15 58105591 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATGTCTGTGACCTGGGAGG -3'
(R):5'- TCGGCCATGTGAAAGTACTG -3'

Sequencing Primer
(F):5'- AGGCAGAGGCATCACCC -3'
(R):5'- GCCATGTGAAAGTACTGCAGTTTC -3'
Posted On2014-10-01