Incidental Mutation 'R2159:Stk36'
ID235021
Institutional Source Beutler Lab
Gene Symbol Stk36
Ensembl Gene ENSMUSG00000033276
Gene Nameserine/threonine kinase 36
Synonyms1700112N14Rik, Fused
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74601445-74636894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74634737 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1263 (Q1263R)
Ref Sequence ENSEMBL: ENSMUSP00000084430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087183] [ENSMUST00000087186] [ENSMUST00000148456]
Predicted Effect probably benign
Transcript: ENSMUST00000087183
AA Change: Q1263R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084430
Gene: ENSMUSG00000033276
AA Change: Q1263R

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
Pfam:HEAT_2 1112 1218 7.8e-11 PFAM
Pfam:HEAT_2 1158 1259 3e-11 PFAM
Pfam:HEAT_EZ 1207 1261 4.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000087186
AA Change: Q1135R
SMART Domains Protein: ENSMUSP00000084433
Gene: ENSMUSG00000033276
AA Change: Q1135R

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 577 590 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 828 841 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
low complexity region 886 902 N/A INTRINSIC
Pfam:HEAT_2 984 1090 2.9e-10 PFAM
Pfam:HEAT_2 1026 1131 9.6e-11 PFAM
Pfam:HEAT_EZ 1039 1092 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145673
Predicted Effect probably benign
Transcript: ENSMUST00000148456
SMART Domains Protein: ENSMUSP00000120020
Gene: ENSMUSG00000033276

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1012 1028 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155473
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause postnatal growth defects and lethality. Homozygotes for a null allele show hydrocephaly, cranial defects, otitis media and sterility. Homozygotes for another null allele show additional defects in lung and renal development, thymus and spleen atrophy, rhinitis and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Stk36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Stk36 APN 1 74634702 missense possibly damaging 0.82
IGL00485:Stk36 APN 1 74634085 missense probably benign
IGL00792:Stk36 APN 1 74611117 missense probably benign 0.01
IGL00941:Stk36 APN 1 74623934 missense possibly damaging 0.85
IGL01324:Stk36 APN 1 74625610 missense possibly damaging 0.66
IGL01538:Stk36 APN 1 74633638 missense probably benign 0.03
IGL02143:Stk36 APN 1 74616569 splice site probably benign
IGL02223:Stk36 APN 1 74623337 missense possibly damaging 0.84
IGL02371:Stk36 APN 1 74622255 missense probably benign 0.13
IGL02618:Stk36 APN 1 74631675 splice site probably benign
IGL02655:Stk36 APN 1 74634535 missense probably damaging 1.00
IGL02993:Stk36 APN 1 74622287 missense probably benign 0.05
IGL03125:Stk36 APN 1 74623313 missense probably damaging 1.00
IGL03242:Stk36 APN 1 74623352 missense possibly damaging 0.70
R0373:Stk36 UTSW 1 74633620 missense probably damaging 0.99
R0377:Stk36 UTSW 1 74612730 missense probably benign
R0464:Stk36 UTSW 1 74611172 missense probably damaging 0.98
R0520:Stk36 UTSW 1 74602206 unclassified probably benign
R0551:Stk36 UTSW 1 74616621 missense probably benign 0.00
R1118:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1119:Stk36 UTSW 1 74632766 missense probably benign 0.29
R1471:Stk36 UTSW 1 74611155 missense probably benign 0.14
R1915:Stk36 UTSW 1 74634187 missense probably benign 0.08
R2290:Stk36 UTSW 1 74626144 splice site probably benign
R2897:Stk36 UTSW 1 74632825 missense probably null
R2898:Stk36 UTSW 1 74632825 missense probably null
R4032:Stk36 UTSW 1 74626048 missense probably benign
R4353:Stk36 UTSW 1 74632807 missense possibly damaging 0.53
R4683:Stk36 UTSW 1 74634185 missense probably benign 0.22
R4753:Stk36 UTSW 1 74626096 missense probably benign 0.05
R4891:Stk36 UTSW 1 74603256 missense probably damaging 1.00
R5068:Stk36 UTSW 1 74622345 missense probably benign 0.00
R5115:Stk36 UTSW 1 74635827 missense probably damaging 1.00
R5266:Stk36 UTSW 1 74611158 missense probably benign
R5412:Stk36 UTSW 1 74605456 unclassified probably null
R5533:Stk36 UTSW 1 74626591 missense possibly damaging 0.65
R5782:Stk36 UTSW 1 74605425 missense possibly damaging 0.81
R6149:Stk36 UTSW 1 74634229 missense probably benign 0.00
R6208:Stk36 UTSW 1 74611432 missense probably benign 0.03
R6497:Stk36 UTSW 1 74603232 missense probably damaging 1.00
R6805:Stk36 UTSW 1 74622239 missense probably benign
R7064:Stk36 UTSW 1 74610820 missense probably damaging 1.00
R7102:Stk36 UTSW 1 74622223 missense probably benign 0.10
R7393:Stk36 UTSW 1 74611193 nonsense probably null
R7408:Stk36 UTSW 1 74633566 missense probably damaging 1.00
R7471:Stk36 UTSW 1 74634320 missense unknown
R7816:Stk36 UTSW 1 74611169 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGATGCTCAGGATGGGATC -3'
(R):5'- AGTTATGACTCCGGGTCTCAG -3'

Sequencing Primer
(F):5'- ATGGGATCCGGCGCAATG -3'
(R):5'- TCTCTAGGATTAGGAAACCCATCTC -3'
Posted On2014-10-01